v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) KCNQ1 antisense RNA 1 (KCNQ1-AS1) URS00007E3B28_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

KCNQ1-AS1: KCNQ1-AS1 is a noncoding RNA gene that is part of the imprinted domain 2, which includes three noncoding RNA genes (KCNQ1OT1, KCNQ1-AS1, and KCNQ1DN) and several protein coding genes [1]. The expression of KCNQ1-AS1 may serve as a mechanism to prevent excessive production of KCNQ1OT1 in certain human tissues [1]. The gene is transcribed in an antisense orientation to KCNQ1OT1 [1]. However, the specific function of KCNQ1-AS1 remains unknown [1]. References: [1] Pandey RR, Mondal T. lncRNA-mediated regulation of imprinted genes in development and diseases. RNA Biol. 2020;17(7):903-913.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGGCAAUGAGGGGCACAGAGGACAGUGUGUGGCUAUCUCUGGGUCUCUGUUCUCCCAGGUGGACCAGUGGGGGUUGUGGCGAUGCUGUCCAGGGUGAGGUCCAGCUACGGUUGCCGUCCUGUCUGUCAGCACCAGCACCCAGCACAUCUGUAGGGCCUGGGCCCCGGACCCAGCCUGAGGGUUAUGAGGAGGUUUCCUGAAGGAGAAAAGCCAGAGUGGAGUCUGGAAUGGAGCAGGGGGGACCAUGGCCUGCCCUCAGUCUGCUAGGUGGGGCUGGAACCUGGGGUUUUGCUUGGGUGUGAAGAAGGAAGAGGCUGGGGAUGCAGCUAGGUGCUGGUUCCUCAUAGACCGAGUCAUGAUUUAUGGGGACCCUCAAUUAUAUCCCCUUAGCAGGGGCCACAAAGUCUCAAAUCUGCCCAGAAAUCCACACCUCGGAGCUCAGGUGAGGUCUUCUUCAGGUUCUCCCUCUGCAGUGCAGAUACUGUCAGAAAGAGCAAGCUACAAAUGGAGAAGUCAACAACACUCUAGUGAGAAUUACCCUGCCAAUUAAUUUUCUCAGAAAUCGGGGACUCAGGGACCGCUUGCUGCCGAGGCUGCCACCUCAGCUGCCUGUCUGUGAAAUGGGUCCAUGUGUCCCCAUGCCUUGGCCCGUCUCCUCUUCCCUACAACAGGCUGCUGUGCAGCCUGGGGCCCUUUCCAGGCCACCUUCUCCAUCUGCUCACUGAGGAGGGACCCCUGAGUCAGCGAGGCUCCAGCUUGGCUGCACCCAGCUGAAAGGUUAUCCUGCUGAUACCCCACCACUUAUGGAAUGAUGGACCUUUUCCCCACUGGAUUAGAAUGUCCUUUUUGUGUAUCAUCGACCCUGAACAACCCAAGUUUGAGCCGUGUGGGUGCACUUCUACGUGGAUUUUCUUCCUCCUCUGUCACCCGAGACAGUAAGAGCCACCCCUCCUCCUCCCCAGCUGACUCAACGUGAAGAUGACGAGGAUGAAGACCUUUACAAUGAUCUGCUUAUGCUGAAUGAAUAUCUUUUCUCUUCCUUACUUUACUUUAUUGUAAUACAUGAAGCAUACAAAAUGUGUUAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications