Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-4259 precursor URS00007E3AE8_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4259: Hsa-mir-4259 is a microRNA implicated in the regulation of various target genes, including those involved in the JAK-STAT signaling pathway, such as SPRY4, and transcription regulation genes [PMC5374554]. Although its whole sequence cannot be aligned onto the human genome, hsa-mir-4259 shares target seed sequences with miR2910 and hsa-miR-4715-5p [PMC5374554]. This microRNA has been detected in saliva samples, but its quantification in plasma samples has not been extensively studied [PMC9481579]. Hsa-mir-4259 was not validated in certain studies that included other miRNAs such as hsa-miR-142-5p and hsa-miR-1293 [PMC9481579]. It was not detected in a selection that included successfully quantified miRNAs like hsa-miR-92a-3p and hsa-miR-486-5p [PMC9481579]. Furthermore, hsa-mir-4259 is associated with pre-miRNA loops that form rG4 structures, which are sequences capable of forming G-quadruplexes [PMC7723054]. It was found to be present only in untreated extracellular vesicles (EVs) and absent from cells and EVs treated with proteinase K and RNase-A/T1 [PMC10138286], indicating its selective presence under certain conditions. Lastly, it is identified among hub genes, suggesting its potential role in gene regulatory networks [PMC9851797].

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GAUGGGCCCCUUGUGUCCUGAAUUGGGUGGGGGCUCUGAGUGGGGAAAGUGGGGGCCUAGGGGAGGUCACAGUUGGGUCUAGGGGUCAGGAGGGCCCAGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Relationships

Molecular Relationships

Expression Publications