Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) WARS2 intronic transcript 1 (WARS2-IT1) URS00007E3A4D_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

WARS2-IT1: WARS2-IT1 is a long non-coding RNA (lncRNA) that has been studied in various contexts, including hepatocellular carcinoma (HCC) and other tumors. It has been found to be significantly upregulated in HCC and is associated with poor prognosis [PMC8184498]. WARS2-IT1 is closely related to AR-LncM risk scores and is one of the seven AR-lncRNAs that are associated with HCC [PMC10057494]. Additionally, WARS2-IT1 is part of a ceRNA regulatory network involving miRNAs (hsa-miR-24-3p, hsa-miR-27a-3p, and hsa-miR-140-5p) and target genes (CD34, SEMA7A, and HDAC7) [PMC8626812]. It has been suggested that WARS2-IT1 may play an inhibitory role in tumorigenesis and the immune microenvironment [PMC8626812]. Furthermore, WARS2-IT1 has been found to be involved in the regulation of COL1A1 through sponging miRNAs (has-mir143 and has-mir98) [PMC7928381]. In the context of HCC recurrence prediction, a four-lncRNA expression-based risk score system including WARS2-IT1 has been developed [PMC8058997]. However, despite its significance in HCC recurrence prediction, the mechanism behind WARS2-IT1's role in HCC recurrence remains unclear [PMC8626812]. References: [PMC8184498] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8184498/ [PMC10057494] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10057494/ [PMC8626812] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8626812/ [PMC7928381] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7928381/ [PMC8058997] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8058997/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GAUACGCAAAAAGCUACCACUAUGUCUCCACGAAGCUGAGUAUUUUCCUUGGAGUAGCUUUUUAUUUGGACAUAUGGAAUGAAACUUACUUAAUAUUCUGCAGAGAUCUUCCUGGUGUUUCCAAAAUGUCUCAGGUAUGUCUUUAUCAGCAUCAUGAAAACAGACUAAUACAGUAAGUUGAUACCAGUACAGUGGGGCAUUGCCGAAAAGAUACCUGAAAAUGUGGAAGUGACUUUGGAACUGGGUAACAGGCAGAGAUUGGAACAGUUUGGAGGGCUCAGAAGAAGAUAGGAAGAUAAGGGAGAGUUUGAAACUUCCUAGAGACUUGUUGAAUGGCUUUGCUCAAAAUGCUGAUAGUGAUAUGGACAAUAAUGUACAGACUGAGGUGGUCUCAGAUGGAGAUGAGGAACUUGUUGGGACCUGGAGCAAAGGUGACUUGUUAUGUUUUAGCAAAGAGACUGGCAGCAUUUUGCCCCUGCCCUAGAGAUUUGUGGAACUUUGAACUUGAGAAAGAUGAUUUAGGGUAUCUGGCAGAAGAAAUUUCUAAGCAGCAAAGCAUUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications