v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) DIAPH2 antisense RNA 1 (DIAPH2-AS1) URS00007E3796_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

DIAPH2-AS1: DIAPH2-AS1 is a gene that has been studied in the context of gastric cancer (GC). Bioinformatics analysis identified six potential binding sites of HOXD8 on the promoter of DIAPH2-AS1 gene [PMC6350042]. In vivo experiments showed that transfection of DIAPH2-AS1 promoted the growth and metastasis of GC cells, while silencing DIAPH2-AS1 had the opposite effect [PMC10086070]. Further investigation revealed that overexpression of DIAPH2-AS1 inhibited the degradation of NSUN2, a protein involved in RNA modification [PMC10086070]. DIAPH2-AS1 was found to interact with NSUN2 and protect it from degradation by the ubiquitin-proteasome system. This interaction enhanced the stability of NTN1 mRNA through an m5C modification-dependent mechanism [PMC10086070]. In summary, DIAPH2-AS1 is a gene that plays a role in gastric cancer. It is regulated by HOXD8 and its overexpression promotes tumor growth and metastasis. Additionally, it interacts with NSUN2 to protect it from degradation and enhance mRNA stability through an m5C modification-dependent mechanism. These findings provide insights into the molecular mechanisms underlying gastric cancer progression [PMC6350042] [PMC10086070].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CCCUUCUACUCCUUCUGCUAUGCGAGAACACAGCGUUUGUCCAUUUCACAAUGUGAGGAUACAGCAAGAAGUGUCAUCUUGGAAGCAGAGAGCAAACACUCAUCAGACAUUAAAUCUGACAGCACCUUGAUCCUGGACUUCCCAGCCUCUAGAAAUUGUAUGCAAUGGUAUGAGGAACUGUUCCACAUUAAAGGAGACUAAGAAGACAUAACAACUCGAUGCAAUGUGUGAUUCUGGACUGGAUCUUGCAUUGGAGGAGAAAAUGCUAUAAAAGUGUCUUGCUCUUUCACCCAGGCUGGAGUGCAGUGGCGCCAUCUCAGCUCACUGCAACCUCCGCCUCCCGGAUUCAAGCGAUUAUCCUGCCUCAGUCUCCUGAGUAGCUGAGAUUACAGACACGUGCCACCAUGUCCAGCAUAUAUAUAUAUAUUUUUGUAGAGAUGGGGUUUCACCAUGUUGGCCAAGCUGGUCUCCUGACCUUGUGAUCUGCCCACCUUGGCCUUUUUUUCUCUAUGUUUCUCUGACUCAACCUUUGACACUUAGAAGGUAGCACACUUCCAACAUAUCCUUCCGUCUUCCAAGAUAUAGUCCAUACAACUUUCCAUAGUUCGAAUGUUUAUCCCCCAAACCUCAUGUUGAAAUUUGAUCCCCAAUGUUGGAAGUGGGGCCCGAUGGGAGGAAUUUGGGUCAUGGAGGUGGAUCCCUCAUGAAUGACUUGAUGUCCUCCUUGUGGUAAUGAGUGAGUUCUUGCUCCAUUAGUUCCUGAGAAAGCUGGUUGUUUAAAAACAAAAACAAAAACCUGUAAGCUCCCUUCCCUCUCUCUUUCUUGUCAUUUGGUCUCUGCACAUGCCAGCUCCCCUUCUCCUUCUGCCAUAAAUGGAAUUAACCUAAAGCCCUCACCAGAAGCAGACGCUGGCACUGUGCUUCCUGUGCAGUCUGCAGAACCGUAAACCAAAUAAAUCUCCUUUCGUUAUAAAUUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications