v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) LENG8 antisense RNA 1 (LENG8-AS1) URS00007E335F_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LENG8-AS1: The expression level of PD-L1 was found to be related to AC004846.1, LENG8-AS1, AC245140.2, SNHG26, AC107375.1, MYOSLID, TMEM147-AS1, AC074117.1, CCDC183-AS1, STAG3L5P-PVRIG2P-PILRB, LINC00174, FAM83C-AS1, AC023157.2, ATP2B1-AS1, AC084125.2, AL137782.1, and AL121906.2 [PMC8789477]. There have been few studies investigating the lncRNAs NUP153-AS1, ZKSCAN2-DT, LENG8-AS1, and CAPN10-DT [PMC9509522]. In a study on kidney renal clear cell carcinoma, LENG8-AS1 was identified as a risky factor with a hazard ratio greater than 1 [PMC9465161]. In colorectal cancer, LENG8-AS1 was found to be upregulated compared to normal tissues [PMC8789477]. Additionally, LENG8-AS1 was identified as one of the markers for CRC prognosis, along with SNHG16, LINC02257, and RPARP-AS1 [PMC10031908].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGCCCCGAGGAGACAAGCGUGGCCGCAUUAGCUCUUUCUGCCUCCCACGCAGCCUUAUUUUUUUUAUUGUUGUUUUCUUGUUGCUGUUGUUGUUGUUCUCGGAGACGGAGUCUUGCUCUUGCUCUGUCGUCGCCCACGAUAGAGUACAGUGGCGUGAUCUCUGCUCACUGCAACCUCCGCCUCCUGGGUUCAAACAAUUCUGCCUCAGCCUCCGGAGUAGCUGGGAUUACAGGCGCGCGCCACUAUGCCCGGCUAAUUUUUGUGUUUUUAGUAAAGACGGGGUUUCACCAUGUCGGCCAGGCUGUUCUCGAACUCCUGACCUCGUGAUCCCUCCGUCUCGGCUUCCCAAAGUGCUGGGAUUACGGGCGUGAGCCACCGUGCCCGGCCGCAGCCUUGUUUUGACUGAGUCAGUGGGAGCCAUUACUGUUCCUAAAUGUAAACUGGCGUGACAGGAGUUCCGGGAUUGUCCACAGCACGGACUCUGAUACAACUAUCCAGUCCGCUGCAGGGACCGGUCACUGUGUCACAGGUUCUCCAGAGGGCCAGAACUAACAGGAUAUAUGUAUAUAUUGAAAGGGAGUAUAUUAGGGAGAACUGGCUGACAGGAUCAUCAGGCAAAGUCCCACUAUAGUCCAUCUGCAAGCUGAGGAAGGAAGAAGCCAGUCACGUCUCAAAGUCCAAAAGCCUCAAAAGUAGGGAAGCCAACGGCGCAGCCUUCAGUCUGUGGCGGAAGGCCUAAGAGUCCCCGACAAACCACUGGUGGAAGUUCAAGAGUCCAAAGGCCAAAGAACCUGGAGUCUAAUCUCCAAAGACAGGAAGUAUCCAGCACAGGAGAAAGAUGAAAGCCAGAAGACUCAGCAAGCCAGCCCCUCCCACCUUCUGCGCUGACUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications