v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 2166 URS00007D06F3_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC02166: LINC02166 is an autophagy-related long non-coding RNA (lncRNA) that has been implicated in various diseases, including low-grade glioma, breast cancer, and ferroptosis-related processes [PMC7755467] [PMC9127066] [PMC10057494] [PMC7810925] [PMC9351903]. In breast cancer, LINC02166 has been found to be overexpressed in tumor tissues and is associated with a poor prognosis for patients [PMC10057494]. Additionally, LINC02166 is one of the lncRNAs included in an autophagy-related prognostic risk model for breast cancer, along with other lncRNAs such as U62317.4 and LINC01871 [PMC7810925]. In the context of immune response, LINC02166 has been identified as one of the immune-associated lncRNAs predictive of low-grade glioma [PMC9127066]. Furthermore, in a study on ferroptosis-related lncRNAs, LINC02166 was identified as one of the five hub lncRNAs associated with ferroptosis processes [PMC9351903]. Overall, these findings highlight the potential role of LINC02166 in various diseases and its potential as a prognostic marker.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGGCUCCAGGGAUCGGCUCCGACUGCUGCAGUUCGGGCCUUAUUUUAGGGUGAAGCCCGGGCAGCCGACCCGGCUGCGCCGUAGUGGGAGGCCACGGCGAUUACCCAGGUGAAGGUCUUCCAGCCCAGCCCUGGAAGGUGGAAAAAGAAAAGUUGACAUGGAAUGUUUAGGAAGCACCAUUGGUCCAGGUCCAGGAUCGGGGCAGCCAGCAUGUCCUCUAAUCUGGCUUCACUGUUGAAAUCCAGUCGAGCAAGCAGGGCCCAAACCACUGCGAGACCAGCUCGGUCGGGCCCAAACCACCGCCCACUGCGAGACCAGCUCGGUCGGGCCCAAACCACCGCCCACUGCGGGACCAGCUCGGUCGGGCCCAAACCACCGCCCACUGCGGGACCAGCUCGGUCGGGCCCAAACCACUGCCCACUGCGGGACCAGCUCGGUCGUGGAGACCCUAACCCAGCGGCGCUAGAGGAAUUAAAGAAACACACACAGAAAUAUAGGUACCUCGCAAGGGUUUUUUGCAUGUCUGAUACCUACGGCUCCAACAGGACCCACUGACUGAUGAUGGCUCCACCUGGACCUGCCAACUACUCCUGCAGCCCCACCCAGAAGCGGUUCAGCACACGGGAGGAUCCUGUCUCACACCCUACGAUGGCCCCCCGCCCCCACAACCCAUCAGCAGCAAGCACCCACUGCCAAGCUACCCCACCCCUUCCCCCAAACU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications