Papio hamadryas (hamadryas baboon) microRNA pha-mir-769 precursor

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Papio hamadryas (hamadryas baboon) microRNA pha-mir-769 precursor URS00007A12A2_9557

61 nucleotides
2 databases (ENA, miRBase)
Found in 2 other species
1 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

UGAGACCUCUGGGUUCUGAGCUGUGAUGUUGCUCUCGAGCUGGGAUCUCCGGGGUCUUGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Homo sapiens (human) Hsa-Mir-769_pre stem-loop
Macaca mulatta microRNA mml-mir-769 precursor

2D structure

Publications