Oreochromis niloticus (Nile tilapia) oni-miR-9a-7-3p

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oreochromis niloticus (Nile tilapia) oni-miR-9a-7-3p URS0000779C7A_8128

22 nucleotides
1 database (miRBase)
Found in 7 other species

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

UAAAGCUAGAGAACCGAAUGUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

Chrysemys picta (Painted turtle) cpi-miR-9-4-3p
Columba livia cli-miR-9-3-3p
Danio rerio (zebrafish) dre-miR-9-4-3p
Python bivittatus (Burmese python) pbv-miR-9-4-3p
Salmo salar (Atlantic salmon) ssa-miR-9b-3p
Taeniopygia guttata Tgu-Mir-9-P4_3p (mature (co-guide))
Tor tambroides (Thai mahseer) miR-9-4-3p