v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hepatocellular carcinoma ferroptosis associative lncRNA (HEPFAL) URS0000770DF3_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

HEPFAL: HEPFAL is a long non-coding RNA (lncRNA) that has been found to increase sensitivity to erastin-induced ferroptosis, potentially through the mediation of mTORC1 [PMC9411508]. Overexpression of HEPFAL has been observed to cause changes in mitochondrial morphology, including smaller size, the disappearance of mitochondrial cristae, and increased density of mitochondrial membrane. However, the nuclear membrane remains intact [PMC9411508]. These findings suggest that HEPFAL may play a role in regulating ferroptosis and mitochondrial function [PMC9411508]. Further research is needed to fully understand the mechanisms by which HEPFAL influences ferroptosis sensitivity and mTORC1 signaling [PMC9411508].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UAGACCACAGGGAGGCCUGGGAACUGCCUGAGCACCUGCACCACGGGAGAGGCUUGGGUGACACUUGGGCACCUGCACCCAACACAGGUAGCAGUGAUCACAGUGAAAACAUUUUGUUAGCAGUCGUCUGCUUCCUGUCCUGGCAUGAGCAGCAACGGGUAAAGGGCACUCUUGUCAGCUGAGGGGAUGAGUGGGGCUCUGCCCAGCUGGUUGGAGACUCCAGCAGGUUUGCAGGAGGAGACGGAAGAGCAAGGAGUGGAGGCAAAAACUGCUGCCAAGAUCCUGUGGGAAAACAGGAACCCAAAGAAGGAACUCCAAUGGGAAACUAAUUUAGACAACAAUGAUCUUAAAGUUUUUGCUCCUUCGAGACUGUUGAAAAGAACUCCCACGAGUGAACAAAAGACGCCUGGCCGAGGACACUCCAGAGUGCUGUCACGAGGGUUCCCUGCAGUUUUCAGAAACUUGGAGCAUGUGGCCACAGCGGCUUGCACGUGAUUCAUACGGCACAUCUUGUCACCAUGUAAAUGUUUAUCAGCAGAGACAAAGACCAGAAGAGCAACCUUGGAAAGAGCUAAAUAUUCCGAUGUUCCAGCAUUUUCCCCUCUGGUUUGUAUUGUGAAUUUUUAAAAUCUCGAUUGACAAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications