v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) Hsa-Mir-9-P1_3p (mature (co-guide)) URS000076199B_9606

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AUAAAGCUAGAUAACCGAAAGUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Columba livia (rock pigeon) cli-miR-9-3p
  2. Dasypus novemcinctus dno-miR-9-3p
  3. Eptesicus fuscus efu-miR-9-3p
  4. Gallus gallus (chicken) gga-miR-9-4-3p
  5. Macaca mulatta mml-miR-9-3p
  6. Mus musculus Mmu-Mir-9-P1_3p (mature (co-guide))
  7. Oryctolagus cuniculus (rabbit) ocu-miR-9-3p
  8. Sphenodon punctatus (tuatara) Spt-Mir-9-P2_3p (mature (co-guide))
  9. Xenopus laevis Xla-Mir-9-P1d_3p (mature (co-guide))
  10. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-4328525
 Publications