v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1346 (LINC01346) URS000075EFAD_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01346: LINC01346 is a long intergenic non-protein coding RNA with unknown functions, located in an intergenic region near an association peak [PMC6597974]. LINC01346 is one of the loci selected for its known R-loop formation at the transcriptional terminal regions [Wongsurawat et al, 2012]. It is also one of the loci known to be regulated by XRN2 [Fong et al, 2015]. The DDX5 RGG/RG motif does not affect its in vitro R-loop resolution activity or association with chromatin, but it prevents interaction with XRN2 for R-loop resolution at transcription termination pause sites of various genes, including LINC01346 [PMC6669924]. Increased R-loops were detected in XRN2- or DDX5-depleted cells at loci such as LINC01346 [PMC6669924]. HIF-3α expression levels have been found to correlate positively with LINC01346 expression levels and induce metastatic potential in ovarian cancer cells [PMC9661682]. DDX5 deficiency leads to R-loop peak gains at previously reported loci, including LINC01346 [PMC7409538].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCGGCGUGCUCGUGCCAUGUGCCUGUCAGUUCUGCAAGCAUUUGUUGGAUGUGAAGGUUGGUGUGAUGACCACGCUGCCCACAACAGGCAAAAGGGUGCGGACAGCUGAGGCUCCUCACUUCCCGCUCCAAAGCUCAGAACCUCCCUUCCCUCCUGGAUCCAACAGAAGCAGCGGCCGCUGCUGCCUGUGCCUCUCAAACUUGUCACCCACGGAUGCUGGGAAAAAUGCACAUAAAAUGACUGGAUGGAGAUGACCCAGGAAGGGGCCCUGUUGCCCAGGAAAUGGGCUUGUCCUGAACCACAGCUUGAAGGAGAGCCACCGACUGAUCAGGAAUACCCAACUGGACUUUAUUCCAGCAACAUACAAAGCAUUACUGUGCUGGGCCAUGGUAUAUUAUUGGGUUUCUUUUAUUAGAACACUUGGCAUUACCUUCACUAAUAUACACUCAUCAUAGUAGACAUUUUCACUAGUUAUAGAUGAUAUGCACUAUUUUCCCUUCUGAAACAGAAAUUUGCAGCAGCACUGCCAAAGGACAAUAGAUUUUUAAAAAUCAUAGAAUGACUGGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications