v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Theropithecus gelada (gelada) miRNA (ENSTGEG00000001237.1) secondary structure diagram

Theropithecus gelada (gelada) miRNA (ENSTGEG00000001237.1) URS000075EA5D_9565

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGCCUGCCCGACACUCUUUCCCUGUUGCACUACUGUGGGCCACUGGGAAGCAGUGCAAUGAUGAAAGGGCAUCGGUCAGGUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Cercocebus atys (Sooty mangabey) miRNA (ENSCATG00000008657.1)
  2. Chlorocebus sabaeus (African green monkey) miRNA (ENSCSAG00000021502.1)
  3. Colobus angolensis palliatus miRNA (ENSCANG00000005360.1)
  4. Macaca fascicularis (Crab-eating macaque) miRNA (ENSMFAG00000007860.2)
  5. Macaca mulatta microRNA mml-mir-130b precursor
  6. Macaca nemestrina miRNA (ENSMNEG00000006820.1)
  7. Mandrillus leucophaeus miRNA (ENSMLEG00000002413.1)
  8. Otolemur garnettii miRNA (ENSOGAG00000017282.1)
  9. Piliocolobus tephrosceles miRNA (ENSPTEG00000004628.1)
  10. Prolemur simus (greater bamboo lemur) miRNA (ENSPSMG00000014233.1)
  11. Propithecus coquereli miRNA (ENSPCOG00000009375.1)
  12. Rhinopithecus bieti miRNA (ENSRBIG00000009265.1)
  13. Rhinopithecus roxellana (Golden snub-nosed monkey) miRNA (ENSRROG00000027325.1)
 2D structure