v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Picoides pubescens (downy woodpecker) mir-1805 microRNA precursor family secondary structure diagram

Picoides pubescens (downy woodpecker) mir-1805 microRNA precursor family URS000075E743_118200

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGAAUAUUCUGGGAGUUGUAGUCUUUCAAACAGAGCUUUGCAAGGACAUACCUGUAUUGGAACACUACAGCUCCCUGAACUUCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Anas platyrhynchos miRNA (ENSAPLG00020001452.1)
  2. Anas platyrhynchos platyrhynchos miRNA (ENSAPLG00000000287.2)
  3. Anas zonorhyncha miRNA (ENSAZOG00000001405.1)
  4. Cairina moschata domestica (muscovy Duck (domestic type)) miRNA (ENSCMMG00000012224.1)
  5. Calypte anna (Anna's hummingbird) mir-1805 microRNA precursor family
  6. Chaetura pelagica (chimney swift) mir-1805 microRNA precursor family
  7. Chrysolophus pictus miRNA (ENSCPIG00010011695.1)
  8. Gallus gallus (chicken) microRNA gga-mir-1805 precursor
  9. Meleagris gallopavo miRNA (ENSMGAG00000000469.2)
  10. Numida meleagris (helmeted guineafowl) miRNA (ENSNMEG00000016239.1)
  11. Patagioenas fasciata monilis mir-1805 microRNA precursor family
  12. Pavo cristatus miRNA (ENSPSTG00000009783.1)
  13. Phasianus colchicus (Ring-necked pheasant) miRNA (ENSPCLG00000018276.1)
 2D structure Publications