v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) GAS8 antisense RNA 1 (GAS8-AS1) URS000075E6C7_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

GAS8-AS1: GAS8-AS1 is a long non-coding RNA (lncRNA) that has been studied in thyroid cancer. Lower expression of GAS8-AS1 has been associated with a poorer prognosis in papillary thyroid carcinoma (PTC), including higher TNM stage and lymph node metastasis (LNM), suggesting its potential role in PTC pathogenesis [PMC7562962]. In PTC cells, the luciferase activity of GAS8-AS1 was significantly reduced when miR-187-3p was upregulated, but this effect was not observed when the cells were co-transfected with a mutated form of GAS8-AS1 [PMC7562962]. GAS8-AS1 is one of several important lncRNAs that have been studied in thyroid cancer, including NEAT1, HOTAIR, PTCSC3, MEG3, BANCR, CASC2, and MALAT1 [PMC10135953]. These lncRNAs have been investigated for their potential roles in thyroid cancer pathogenesis and prognosis.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
ACCUGCAGUCCCAGCUACUGGGCAGCCUGAAGCAGCAGGAUGGUGUGAACCCAGGAGGUGGAGCUUGCAGUGAGCCGAGGUCGCGCCACCGCACUCCAGCCUGGGCCACACAGCGAGAUUCCGUCAGAAUCAGUUACUUUUCGGGCACAGCCCCAGGCCACUUACUGUGAGCCUUUUUCUUUCUCAACACCACAUUCCCCACAGGGAAAACACAUUUCUCACCUCAAAAGAAGACAAGACAACGAGCAAACAAGAAGGAGCAGCAGGAGGGGUUCUGAGCCGAGGAUGCCGGGCAGACAUGAGGGAGACACGCACCCCCGAAUCCAACCAGUGCCUCGGCACAACGACAAAUGUCUUCACGUCACAGACCUUUAGAGGCUCCUGGGCAGAGCCUGAACCAGGGCUCCUGACUGGUCUGUUUGGCUCACAUGGUGUUGAGAUUUUGCCAUCACUCAAUAUUCAGAUUUCUUAUAAAUAUCCAGAUUUCCAGCUUCUCUUGGAAAAUCAGAAAAAAACAGCACUGAACUCCUAGGCCCACAAGGCACUCCCCAGUGAACAGAUGAAACUGUCCUCUGCUGCGGGGCAGGAGUCUCCAGGUCACCCCCAUCCCUCCCCACCUGCCUGGACCCUGAAGAAGCCUUCUGAGUCUGUGGCUCAACGUGCGAUGUGCAGUGCAAGGGCCUGCCCCGUAGCCUGCCCCGUAGGCUGCCCCAUAGCCUGCCCCGUAAGCUGCCCCGUAGCCUGCCCCGUAGGCUGCCCCGUAGGCUCCAUGGCCACUGCCCCACAAGGCCUGUCUCCACAGGAAUGGGAAGCGGACAGGGAGACGGGCAGCAGCUCACAUGCUGGGACAACGCAGUGUUCAAUCCAUUCUCCAUCCAGCAGCUCCAGACAUCUUUCCAGAACACAAACCUGACCCCAUCACCUCUCUGCUUAGCCACUGGCUUAAACUGCCAAUGGUUUGCCUGCAUGUAAAAUAAAGCCAUUCUUUACCAUUAAAAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications