Takifugu rubripes (torafugu) fru-miR-135b URS000075E6B9_31033

• 22 nucleotides
• 2 databases (miRBase, RefSeq)
• Found in 7 other species
• 78 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

UAUGGCUUUUUAUUCCUAUCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

1. Danio rerio (zebrafish) dre-miR-135b-5p
2. Ictalurus punctatus (channel catfish) ipu-miR-135b
3. Maylandia zebra mze-miR-135a
4. Neolamprologus brichardi (lyretail cichlid) nbr-miR-135a
5. Oreochromis niloticus (Nile tilapia) oni-miR-135a
6. Pundamilia nyererei pny-miR-135a
7. Tetraodon nigroviridis tni-miR-135b

Publications Download

• FASTA
• JSON