v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1363 (LINC01363) URS000075E66A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01363: LINC01363 is a long non-coding RNA (lncRNA) that has been identified as one of the 11 lncRNAs with the highest expression in exosomal RNA from BPE and MPE samples [PMC9756994]. The expression of LINC01363 was found to be significantly higher in MPE compared to BPE [PMC9756994]. RBGS4, also known as LINC01363, is a locus that encodes this lncRNA and has not been previously associated with obesity and weight loss interventions [PMC6358625]. LINC01363 has been shown to be upregulated in breast, ovarian, and cervical cancer and is associated with worse prognosis [PMC7865736]. Additionally, LINC01363 has been found to be highly associated with worse chemo-response in cancer patients [PMC7865736]. In a study investigating the effects of DHA treatment on gene expression, LINC01363 was one of the genes that were upregulated at 12 hours but not differentially expressed at 24 hours [PMC7277693]. Overall, LINC01363 is an lncRNA that shows differential expression in various diseases and may have implications for prognosis and treatment response.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
ACCAGAAAUAGAUCUUGGCAUUCCAGGCAACGGAAGAGCCUGAAUGUGUCCUGACUUCUUGCUUAGCAAAAUUGGAUCACCCUGCACUUUGGGAGGCCGAGGCGGGCGGAUCACGAGGUCAGGAGAUCGAGACCAUCCCAGCUAAAACGCCUGAUUAUAGUAACUGGCUCUGAAUUGCUGCUUCUGCUCAACUUCCUGGAUGCUAGCAGUACCCAGGGAUGUAAAGACCUUUCAACUAGAGCUCAUAGCAGGCCCUUGUGUCUGAGAAUGACUGCUUCUGUGAUCUGAUGAGCACACGUGGUGUGCAUCCAGUGGCUCUGCUCUUAAACUAGGCCCAUGACUACCAACAGUCAUUCUUCCUGGGCUGCUGAGACCAGAAAAUAAAAGUGCCUUCCAAAGGGUUCACAGAUGCAGAGGAAUUUUGCCUCAGGAUGAAUUGCAUCUUCAGUCUCACCCAAACCUGAUUUAGAUAAUAUUUCAAUGAGACUUCGGACUUCAGACUUUACAGUUGAUGCUGCAACCAGUUAAGGCUUUUGGGAUUGUCGGAAUGGAAUGAAUGUAUUUUGCAUGUGAGAAGAACAUGAAGUGUGGGGGGGCCAUGGGCAGAAUAUUAUGGAUUGCAUGAUUUUGUCUCCCCAGAAUACAUAUGUUGAAAUUCUAAUCCCCAAUGUGAUGGUAUUAUGUGGUGGGAACUUUGGGAGGUAAUUAGGUUAUGAGGGUGGAGACCUCAUGUAAAGGAUUAGUGCCCUUAUAAGAAGAAACACAAGAGCUUGCUUCCUCUCUCUGCUCUCCACUAUGUGAAGAUAGAACAAGAAGAUGGCCAUCUGCAAACCAGGAAGAGAGCCCUCAUCAGACACUGGAUCUGCCAGCACCUUGAUCCUGGACUUCACAGCCUCCAGAACUGUGAGAAAUACAUAUAUGUUUUUUAAAGCACCCAGUCUGUGGCAUUUUGUUGUAGCAACCUGAGCUAAAACAGUUGCUAUUGAACUCUGUUCAGAGCUCCAGAUGUCCUGUGCUGGCACUGGGCAGGGUGCUCUCCUGGGCCAUUUCAUCAGCUCAGAGGCCUCACCUUCCACCAUAUGCUGAAGACCUCAAAUCUACAUCACAGUGAGACCUCCCCUGAGGUCUAGGCUAUUAAGUUGUAAGAUCUAUAAAAGCUUUCAUCACCUCACUUCCCUACUGGCCUUUACUCACCCUUCAAAAUGAUAAUUGUGUUAGUCAUUGAAAGAUGUGGCUGGGAUGAGAGUUCAGUUUACAGACUCUGCAGCUGGACUGCCUGGGUUCUGCCCUGGUUCCACCAUUAACUAGCUGGUAUCCAUGGACAAAUUGGUAUCUUCUCGGUGCCUCAGCUCCCUCUUUUCUAGAAUGAGGGGUAAUGACAGUGUCUCCCUCAUAGAUUGGAUGUGAGGAUUAGAUGAGUUUAACAGAUGUAAAGUACUUACAACAGUUCCUGGCACAUAAUAAGCUCUUACUAUAUCAGGAACUAGCUUAUUCUGUGCUUGUUAGUGUUUUAAUUUAAUUCUUAGAGUAGCCCGAUGAGGCUUUGAGAGAACUUGCCCAGUUCCAGAGCUUAAGCUCUCAACUCCGUGCUGUUUUCUUGUCUUAAGGCAUAAACACUGUUGAGCCUUGGCCGAUUCCUGGCAGAGCCAGGCGCUCCCUCCUCCAUGUUGUCACCCUACUCCAGGCUUGCUCACCCUACUGUGGGCUUGUGCAUCAGCUCUCCACAGCUGCUUCUCACCUGUAAAAAAUCAGGCUUCGUUUGUCUCAUUCUUGCCAUAGAAUGCCUUGUCCAAUUAUAUGCAAGCUUAGUACAUGUUGUUAAAUAAAAGAUUCAAUAAACGAAUUCAUAAACAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications