v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cercocebus atys (Sooty mangabey) microRNA 6125 (ENSCATG00000015826.1) URS000075E538_9531

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCUCUGGGGCGUGCCGCCGCCGUCGCUGCCACCUCCCCUACCGCUAGUGGAAGAAGAUGGCGGAAGGCGGAGCGGCGGAUCUGGACACCCAGCGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

  1. Chlorocebus sabaeus (African green monkey) microRNA 6125 (ENSCSAG00000023695.1)
  2. Colobus angolensis palliatus miRNA (ENSCANG00000010419.1)
  3. Homo sapiens (human) microRNA hsa-mir-6125 precursor
  4. Macaca mulatta (Macaque) microRNA 6125 (ENSMMUG00000041119.2)
  5. Macaca nemestrina microRNA 6125 (ENSMNEG00000000159.1)
  6. Nomascus leucogenys microRNA 6125 (ENSNLEG00000028513.1)
  7. Pan paniscus microRNA 6125 (ENSPPAG00000019717.1)
  8. Pan troglodytes microRNA 6125 (ENSPTRG00000042729.1)
  9. Papio anubis (olive baboon) microRNA 6125 (ENSPANG00000020202.3)
  10. Piliocolobus tephrosceles microRNA 6125 (ENSPTEG00000026520.1)
  11. Pongo abelii microRNA 6125 (ENSPPYG00000041686.1)
  12. Rhinopithecus bieti microRNA 6125 (ENSRBIG00000020320.1)
  13. Rhinopithecus roxellana (Golden snub-nosed monkey) microRNA 6125 (ENSRROG00000018174.1)
  14. Theropithecus gelada (gelada) microRNA 6125 (ENSTGEG00000019540.1)