Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-1202 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-1202 precursor URS000075E4E5_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1202: Hsa-mir-1202 is a microRNA that has been reported to be down-regulated in patients with depression [PMC4867432]. This down-regulation suggests that mental state may contribute to changes in the profile of circulating microRNAs [PMC4867432]. Anova analysis has shown a significant difference in the expression of hsa-miR-4270, hsa-miR-1225-5p, hsa-mir-1202, hsa-miR-1207, and hsa-miR-1290 based on the stage of cancer [PMC4867432].

MIR1202: The DE miRNAs in cluster 4 included MIR1202, MIR1207, MIR1243, MIR1246, MIR1307, MIR1469, MIR1915, MIR2861, MIR3130, MIR3143, MIR3178, MIR3191, MIR3196, MIR3202, MIR320A, MIR320E, MIR3613, MIR3621, MIR3665, MIR3667, MIR3679, MIR3684, MIR4261, MIR4267, MIR4280, MIR4281, MIR4330, MIR494, MIR500B, MIR514B, MIR550, MIR560, MIR638, and MIRLET7A2 [PMC8235499]. The nearby gene rs213382 is not linked to MIR1202 [PMC8718598]. The rs140092351 locus, located on MIR1202, has the most significant association with COVID-19 and interacts with multiple exposure factors [PMC7801182]. MIR1202 directly targets Rab1a and overexpression of MIR1202 inhibits the activation of the TLR4/NF-κB inflammatory signaling pathway, exerting neuroprotective effects [PMC9585453]. In exosomes, MIR1202 exhibits a 45-fold increase and is enriched in mesenchymal stem cells (MSCs) [PMC4598952]. In depressed patients, blood MIR1202 levels are inversely correlated with treatment response to antidepressants [PMC8999364]. Additionally, miR101, miR548b, miR554, and miR370 are potential therapeutic targets in PCNSL patients along with MIR1202 [PMC9428130]. A fusion transcript between RUNX1 and a sequence near the MIR1202 locus has been identified in t(6;21) chromosomal translocations [PMC5055202]. Furthermore, vesicles containing MIR451, MIR630, and MIR638 repress TLR expression to mitigate mitochondrial-transfer-induced inflammation caused by excessive mtDNA in macrophages [PMC8548694].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCUGCUGCAGAGGUGCCAGCUGCAGUGGGGGAGGCACUGCCAGGGCUGCCCACUCUGCUUAGCCAGCAGGUGCCAAGAACAGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

2D structure Publications