Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Bubo bubo (Eurasian eagle-owl) miRNA (ENSBOBG00000012201.1) secondary structure diagram

Bubo bubo (Eurasian eagle-owl) miRNA (ENSBOBG00000012201.1) URS000075E3F0_30461

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUGCUUUUUGUACUAAGGUGCAUCUAGUGCAGAUAGUGAAGUAGAUUAGCAUCUACUGCCCUAAGUGCUCCUUCUGGCAUAAGAAGUUAUGUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 44 other species

  1. Amazona collaria microRNA 18a (ENSACOG00000009377.1)
  2. Anas platyrhynchos microRNA 18a (ENSAPLG00020012262.1)
  3. Anas platyrhynchos platyrhynchos microRNA 18a (ENSAPLG00000000296.2)
  4. Anas zonorhyncha miRNA (ENSAZOG00000002891.1)
  5. Apteryx haastii (Great spotted kiwi) miRNA (ENSAHAG00000018880.1)
  6. Apteryx owenii (little spotted kiwi) microRNA 18a (ENSAOWG00000019213.1)
  7. Apteryx rowi microRNA 18a (ENSARWG00000001652.1)
  8. Athene cunicularia microRNA 18a (ENSACUG00000008364.1)
  9. Cairina moschata domestica (muscovy Duck (domestic type)) miRNA (ENSCMMG00000008456.1)
  10. Calidris pugnax microRNA 18a (ENSCPUG00000016351.1)
  11. Calidris pygmaea (Spoon-billed sandpiper) microRNA 18a (ENSCPGG00000011135.1)
  12. Camarhynchus parvulus miRNA (ENSCPVG00000012612.2)
  13. Catharus ustulatus miRNA (ENSCUSG00005010952.1)
  14. Chrysolophus pictus microRNA 18a (ENSCPIG00010009479.1)
  15. Corvus moneduloides miRNA (ENSCMUG00000003960.2)
  16. Coturnix japonica microRNA 18a (ENSCJPG00005019436.1)
  17. Cyanistes caeruleus (blue tit) microRNA 18a (ENSCCEG00000000378.1)
  18. Cyanoderma ruficeps microRNA 18a (ENSCRFG00000011356.1)
  19. Dromaius novaehollandiae (emu) microRNA 18a (ENSDNVG00000003134.1)
  20. Chloebia gouldiae (Gouldian finch) miRNA (ENSEGOG00005002233.1)
  21. Falco tinnunculus (common kestrel) miRNA (ENSFTIG00000002897.1)
  22. Ficedula albicollis microRNA 18a (ENSFALG00000015366.2)
  23. Gallus gallus (chicken) microRNA gga-mir-18a precursor
  24. Geospiza fortis (medium ground-finch) microRNA 18a (ENSGFOG00000007186.1)
  25. Junco hyemalis (dark-eyed junco) microRNA 18a (ENSJHYG00000010589.1)
  26. Lepidothrix coronata miRNA (ENSLCOG00000006342.1)
  27. Lonchura striata domestica (Bengalese finch) miRNA (ENSLSDG00000014136.1)
  28. Malurus cyaneus samueli (superb fairywren) miRNA (ENSMCSG00000012351.1)
  29. Manacus vitellinus miRNA (ENSMVIG00005011774.1)
  30. Meleagris gallopavo microRNA 18a (ENSMGAG00000000090.2)
  31. Melopsittacus undulatus miRNA (ENSMUNG00000012790.2)
  32. Nothoprocta perdicaria (Chilean tinamou) microRNA 18a (ENSNPEG00000007789.1)
  33. Numida meleagris (helmeted guineafowl) microRNA 18a (ENSNMEG00000020426.1)
  34. Otus sunia (Oriental scops-owl) miRNA (ENSOSUG00000004427.1)
  35. Parus major microRNA 18a (ENSPMJG00000013153.1)
  36. Phasianus colchicus (Ring-necked pheasant) microRNA 18a (ENSPCLG00000013809.1)
  37. Serinus canaria microRNA 18a (ENSSCAG00000015855.1)
  38. Strigops habroptila microRNA 18a (ENSSHBG00005010560.1)
  39. Strix occidentalis caurina (northern spotted owl) miRNA (ENSSOCG00000014743.1)
  40. Struthio camelus australis (African ostrich) microRNA 18a (ENSSCUG00000010571.1)
  41. Taeniopygia guttata (zebra finch) microRNA 18a (ENSTGUG00000017721.2)
  42. Zonotrichia albicollis miRNA (ENSZALG00000008447.1)
  43. Zosterops lateralis melanops microRNA 18a (ENSZLMG00000000639.1)
2D structure