v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1370 (LINC01370) URS000075E146_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01370: LINC01370, also known as HI-LNC25, is a long intergenic non-coding RNA (lncRNA) located on chromosome 20 [PMC8589412]. Knockdown of LINC01370 does not affect the expression of MAFB, a neighboring gene on chromosome 20, but it does decrease the expression of GLIS3, which is located on chromosome 9 [PMC8589412]. LINC01370 is specifically expressed in the liver [PMC5678103]. In silico analyses suggest that LINC01370 may be involved in pathways related to blood complement and coagulation, steroid metabolism, and lipid metabolism [PMC5678103]. The 20q12 locus contains only one gene, LINC01370 [PMC5678103]. The expression of LINC01370 in the liver is associated with a genetic variant (rs6028718) in the 20q12 locus [PMC5678103]. Co-expression analysis reveals that LINC01370 is associated with lipid metabolism-related terms and pathways [PMC5678103]. The function of LINC01370 in idiopathic osteonecrosis of the femoral head (IONFH) is currently unknown [PMC5678103]. However, it has been identified as a candidate susceptibility gene for IONFH based on genome-wide association studies [PMC5678103]. Additionally, Kaplan-Meier survival analysis suggests that LINC01370 may be associated with overall survival after surgery in patients with an unspecified condition [PMC8767542].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AAACUACCAUUUGGUGUCCUGCUGAGACAAGAAAAUAUUUUCACAACUCAAGACAAGUUAAAUAUCCACUUAUGGGAACAGUGCUGAAGGCCUGGACUAGGAUGGUAGCAAUGGAGACAGACUAAAGGUCAGCAUAACAGUCAACAUUAAGGGGGUUGAAUCAACAGCACAUAGUACCUGAUUGGAAAUACAGAGUAAAUUACAGUGAGAAAAAGAGAUGCAAUCAUUCCCUUGCAUAUGGUCCGUAUGAAGACGGGAUCAUUACAGGAAAGGUGAAGGAGAUACAGUCAUUAUGCUCUAUAUACACCCAUUUUUAUGGCUAGCGGCUGAAGAUGGGAUGCUUUCUUUGCUGGAAGACCUAUUACCUGUUAGGUUGCAAAAGAUGUGAUCAUCUUCCUAAACAAUAAUUUAGAGUCCCAUAACAAUUUUAAGUGUGCUGUUCAUGAAAAUUUGAAUACAUUGUAUUGGGAAUAUAAUGGAAGUGAGAUGCCUCAUGUCGUGAGAAAAUCUGACAUAAACUCCUUAAGCAUGAGAGGCCAUGUGGGUAUGGAAGCCCUGAAAGGGAGGAAAAAACAGCCAGACCCUAGCUGUUCCAGUCAUCCCAACUGAGGUGCCAGACUUGUGAUUGAGGCCAUCUUGCAUCAUCUAGGCCUAGUAGAGCUGCCAACUGACUGCAGACACAUGAGUCAAUCCAGCUAAUGCCACAUGGAGCAGAGACAAGCCGCCCAGCUGAGCCCAGUCCAGAUGACAGAAUCAUGAGCAAAUAAGGUUGUUGUUCUUUUAAGCCACUAAAUUUUCGGGUGAUUUGUUACACAGUAAUAAAUAACUGAAACAACUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications