v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) ATP2A1 antisense RNA 1 (ATP2A1-AS1) URS000075E145_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ATP2A1-AS1: ATP2A1-AS1 is a long non-coding RNA (lncRNA) that has been studied in relation to multiple cancers and is considered a potential prognostic biomarker for cervical cancer (CC) [1]. It has been found to upregulate the expression of E2F family transcription factors E2F1 and E2F2 [2]. In addition to CC, ATP2A1-AS1 has been associated with genomic instability in endometrial cancer (EC) [3]. It is considered a high-risk lncRNA in the prognostic risk model for EC patients [4]. Overall, ATP2A1-AS1 has shown potential as a prognostic biomarker in multiple cancers such as CC and EC [1][4].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GUGGCCCCCCGCGCCGCAGCCGGCAUCGCGGCGGGACCCGGAGCCCGGAGUUCGGGUGGGUAACCCGAGCUCUCCAAGCUCUUGAAGCCGCGAGGGUGGCUUAGCUUCGGUGUUUUGGCUGAGAACACCCUUAAAGCUUAAAAUAAAACCUGCCUCUGGGGUGCAGGGGAGGAGAGAGGAGGACGCGAAUCACACCCGCUGCUGCGCGCCAGCCCGCCCCGUCUGUACAAUGGGAUGCUCGGGACUCGGACGGGAGGAUCCAGUGACUGCGAGCCCCGCAUUCGCCCGAUCCCAGCCUCACACCCCCAGCCAGCCCCCAGAGACCCUCCCACACUUACGAAGGAAAUGCAUGCGGCCAGGAGGAGAAUCCGCACCAGGAGGUCUUCAAACUGCUCUAUCACCAGCUCCCACAGGGUCUUCCCUGGGGGAGGAGCAGGGAGCUCUACCCAGGAAAAAGAAGAAAAGGACAGAUUCAUUUGGGGUUCAGCCUCAUGCCCCCCACACCCAAGACUUUGUGGCUAAGAGAAUCAGGCCACCUUGAGGUUCAUCAAGUUCAUCCCAUUAAAACCUCCCAAAACUCUGGAAAAAAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications