Pan troglodytes (chimpanzee) mir-1281 microRNA precursor family

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pan troglodytes (chimpanzee) mir-1281 microRNA precursor family URS000075DF7B_9598

54 nucleotides
2 databases (ENA, Rfam)
Found in 7 other species
152 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

AGGGGGCACCGGGAGGAGGUGAGUGUCUCUUGUCGCCUCCUCCUCUCCCCCCUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

Chlorocebus sabaeus (African green monkey) microRNA 1281 (ENSCSAG00000025578.1)
Colobus angolensis palliatus miRNA (ENSCANG00000004267.1)
Gorilla gorilla gorilla (western lowland gorilla) mir-1281 microRNA precursor family
Homo sapiens microRNA hsa-mir-1281 precursor
Papio anubis microRNA 1281 (ENSPANG00000045877.1)
Pongo abelii microRNA 1281 (ENSPPYG00000023862.2)
Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-1281 precursor

2D structure

Publications