Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-208b precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-208b precursor URS000075DEE7_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mir208b: MIR208B is a microRNA encoded by an intron of the Myh7 gene, which is associated with the fetal isoform of myosin heavy chain in the heart [PMC5586433]. It exhibits sex- and hypertrophy-dependent differences in expression, with an increase in MIR208B levels reported during hypertrophy [PMC5586433]. While miR208a is involved in the switch from Myh6 to Myh7 during cardiac stress and hypothyroidism, the role of MIR208B in this process is not explicitly mentioned [PMC5586433]. The regulation of MIR208B is complex; it is activated by ESRRG and inhibited by PPARα, which influences the expression of Myh7 [PMC5586433]. MIR208B serves as a potential diagnostic and prognostic marker in pathological conditions such as atherosclerosis and acute coronary syndrome (ACS) [PMC7123062]. It contributes to cardiac hypertrophy by downregulating MYH6 and upregulating MYH7 expression [PMC7123062]. Additionally, MIR208B has been implicated in skeletal muscle fiber type switch by repressing genes such as Sox6 through post-transcriptional degradation mechanisms [PMC4488424], and this may contribute to muscle plasticity during atrophy or disease progression such as ALS [PMC8260947; PMC5573384].

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCUCUCAGGGAAGCUUUUUGCUCGAAUUAUGUUUCUGAUCCGAAUAUAAGACGAACAAAAGGUUUGUCUGAGGGCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 21 other species

Relationships

Molecular Relationships

2D structure

Loading 2D structure...

Expression GoFlow Results Publications