Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-758 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-758 precursor URS000075DEC1_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mir758: MIR758 is a microRNA (miRNA) that has been studied in the context of its expression in relation to certain treatments and its location within the genome. Treatment with a specific agent for 24 hours was found to reduce the expression of several miRNAs, including MIR758, as shown by qRT-PCR results [PMC6100038]. MIR758, along with other miRNAs, has been identified as having a role in inhibiting the expression or function of the ATP-binding cassette transporter A1 (ABCA1) [PMC6100038]. However, there is no evidence provided that MIR758 expression is associated with cellular processes such as proliferation and differentiation, nor that it has been implicated in neuroblastoma progression [PMC9866967]. In canine genomes, MIR758 is notably located within a cluster of differentially expressed (DE) miRNAs on chromosome 8 [PMC8376273]. This cluster includes several other miRNAs that have been profiled for their expression levels [PMC10148110].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCCUGGAUACAUGAGAUGGUUGACCAGAGAGCACACGCUUUAUUUGUGCCGUUUGUGACCUGGUCCACUAACCCUCAGUAUCUAAUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Relationships

Molecular Relationships

2D structure

Loading 2D structure...

Expression Publications