v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) NAPA antisense RNA 1 (NAPA-AS1) URS000075DEA4_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

NAPA-AS1: NAPA-AS1 is a long non-coding RNA (lncRNA) that was identified in a study that analyzed the expression levels of various RNAs in ischemic stroke patients [PMC8990852]. The study found that the relative expression of NAPA-AS1 in the ischemic stroke group was significantly higher than that in the control group [PMC8415716]. Additionally, NAPA-AS1 was found to interact with miR-24-3p, along with three other lncRNAs (KCNQ1OT1, SND1-IT1, and LINC01001) [PMC8415716]. These interactions may play a role in regulating LPAR3 and ADORA1 in ischemic stroke [PMC8415716]. The study also identified other RNAs that showed differential expression levels between the ischemic stroke group and the control group. For example, SND1-IT1 showed significantly lower expression levels in the ischemic stroke group compared to the control group [PMC8415716]. On the other hand, miR-24-3p and miR-93-3p showed significantly higher expression levels in the ischemic stroke group compared to the control group [PMC8990852]. Overall, these findings suggest that NAPA-AS1 may be involved in regulating chromatin and nucleosome assembly during ischemic stress. The study highlights NAPA-AS1 along with KCNQ1OT1 and LINC01001 as potential players in this process [PMC8415716]. Further research is needed to fully understand their roles and mechanisms of action.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGCUGCCGGCGUUGCCCUCUCCCAAGAUGGCGGCCAGGUCGCCUGCUCGGGCCUCCCAGGCGACUUUGCCCCACUGCGCCCGCGCUCUCUUCUCCUUUCCAUUUCUGGACCAAGGGGCUGCCAUAAGGAGUCUGUGACUAGAGAUGGGAGGUGGUGGCCACGGCCUCUCGCUGUAUGCUGUGUGGAAGGUCGAAUCAUCAUCAUCAUAAAACUUAAUAUUGCCCUUAUGUGCCAGGAACUACUAUCUCAGCAAUGGAGAUGUGGUGCUUGGCCGCAAUCGUGAAUCGGCCCUGGAGGGGACACAGGAAGGGGCUGCCUGCGACUCAUGACCUCCUGCGUGCCUGCCUGCUGACCUAUGACCCUUCAAGUUCCCACCCCUCAGCCACGCCUGUGAGGAGGGUCUUGUUUUGUCGCCUACGCUGGAGUGCAGUGGUGUGAUCACAGCUCACUGCAGCCUCAACUUCCUGGACUCAAGCGAUUUUCCUGCCUCAACCUCCCAAGAACUAGGACCCCAGAUCCCCAUGGACAAGGCACUUGCAUGAAUUGUGAGGCUCAUGGAGUUGGGGUCGGACAACACAGAGCCGGCUCCCUCCAGGAGCUGCAUGUCCAGAGAGGGAAACAGGAUGUGGACAGCAAGAAUGAAUACAUGCAGACCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications