Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pundamilia nyererei pny-miR-190b URS000075DE35_303518

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAUAUGUUUGAUAUUCGGUUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

  1. Danio rerio dre-miR-190b
  2. Gadus morhua Gmo-Mir-190-P3_5p (mature (guide))
  3. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-190b
  4. Ictalurus punctatus (channel catfish) ipu-miR-190b
  5. Maylandia zebra (zebra mbuna) mze-miR-190b
  6. Monopterus albus (swamp eel) Mal-Mir-190-P3_5p (mature (guide))
  7. Neolamprologus brichardi (lyretail cichlid) nbr-miR-190b
  8. Oreochromis niloticus (Nile tilapia) oni-miR-190b
  9. Oryzias latipes (Japanese medaka) ola-miR-190b
  10. Salmo salar ssa-miR-190b-5p
  11. Tetraodon nigroviridis Tni-Mir-190-P3_5p (mature (guide))
  12. Tor tambroides MIR2