v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) CFAP58 divergent transcript (CFAP58-DT) URS000075DD99_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

CFAP58-DT: CFAP58-DT is a long non-coding RNA (lncRNA) that has been identified as a TP53 pathway-related lncRNA in Uterine Corpus Endometrial Carcinoma (UCEC) [PMC9576376]. It has been reported to be associated with genome instability [PMC9576376]. CFAP58-DT is one of the five lncRNAs in the GIlncSig model, which is associated with prognosis in UCEC [PMC8806732]. In vitro cell experiments have shown that CFAP58-DT knockdown reduces cell viability, invasion, and migration abilities in UCEC cells [PMC9951017]. CFAP58-DT has also been implicated in bladder cancer and shown to be a risk factor associated with poor prognosis [PMC8424867]. It has been suggested that CFAP58-DT may play a role in the innate immune response to viral infection, but its role in tumor treatment remains unclear [PMC8424867]. Additionally, CFAP58-DT has been found to block Hepatitis C Virus (HCV) replication by binding to MDA5 and promoting its activation [PMC7139329]. Overall, CFAP58-DT is an important lncRNA that is associated with genome instability and prognosis in various cancers. Further research is needed to fully understand its mechanisms of action and potential therapeutic applications.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGGCAGAUGGAGACACCCAGGAGAAAGAAGAGGGCGAAUUGGAAGAGGCCACCCAGAAAGGACGGUGUGUGACACUAGGGAGCCAAGCAUGGAGAGCCGAGGACUAACGCUUGGAAGGAAAUGUGGACCAGAAGGUUCCGGAUGAGGGAAGGACUGGCGGCUACACUCUGCCUUCCGAGACAACGAGGAAUAAUCUCACUUCAGUCAGUUCAACCCUUGUAAAACAGCUACUGUGUGCAAGACACGGAGGGAAAGCUGAAGUAGAGAAACCACAGACGCUGUCUUCAAAGGGUUUAAUCUAAUAUUAGUGAUGAGAAAAAUAGGGUGCAGAGCUUAAGGCAUCCUGGAAAAACGUAUGUAGCGCCACAUCGCGAAAAUCUCUCUUCUGGGACCCCUCUCCCAAAAACGUUUCUUCGCCCUCUUCUCCCCCUUCUGCCUCCACUCUUUCUGGACUUCAGAUAUCUUUGAGAAGCCUGGACAUCAAUCUGCUUUAGAAGACUAGAAACUCUGCCUUUAUGUCUUUAAGGGAACAAUAGUCCUUAACUUUGAUACUGUGGCUCUUUAGCUCUUUUUUUCCCUAUAUUUUUUAUAUAGUUUUUUGGUAUUAUUUAGACCUCCUUAACCCCACGGUCAUAAAGGUAUUCUCCCAUCAUUUUUUUCUAUCCAUUAGCUUCAUAGUUUUACUUUUUUACAUUCAGUUAUCUAAUCCAUCUGGAGUUCUCCUUCCCAUAUGGUGUGAGAUAGGGAUCUAACUAUAUUUUUCUCCAUGGGGUGAGCAAAUUUUCCAACAACCCAUGUCAAACAAUCCAUUCUUUCCAAAUUGGUUUGGGGAAGUUUCCAAAUAGACAUGAGUAUGUUCUGAGCUCUCUGGUUUGUUCAUGUGUCAGUACCACAAGGUUUUGUCACUGUGGGUUUUUAGUUAGUCAUCAUGCUUGAAGGGCAAGUUCCCCAUUCCAAAUUCUUCUGUGUUAAGAUUGCUUUGUCUAUCCACGGGCCUUUAUCCUCCCUUAUAAUGUUUAGAGUAAGUUUGUCAAGUUUAUGAGAACUGUGUUGGGUUGAUGAAUAAAUGCAAGGAAAACUGGCAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications