Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-5100 precursor URS000075DAD1_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mir5100: MIR5100 is a microRNA implicated in the regulation of various cellular processes in mouse bone marrow stromal cells (BMSCs) [PMC9391248]. It has been shown to play a significant role in the regulation of BMSC proliferation and migration [PMC9391248]. Transfection of BMSCs with MIR5100 mimics resulted in altered expression levels of transcripts related to adhesion, migration, and IGF signaling, with a notable downregulation of MMP12 and IGFBP2 proteins [PMC9391248]. MIR5100 also affects the fusion of human myoblasts in vitro, suggesting its role in cellular movement and interaction [PMC9391248]. Additionally, MIR5100 has been associated with the promotion of osteogenic differentiation by downregulating TOB2 expression [PMC9391248]. In cancer cells, MIR5100 is involved in proliferation and migration through mechanisms such as targeting TOB2 and activating SMAD2/3 signaling pathways [PMC9391248]. The microRNA's overexpression leads to significant changes in gene expression profiles within BMSCs, indicating its potential as a target for modulating cell behavior [PMC9391248].

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCAUGAGGAGCUGGCAGUGGGAUGGCCUGGGGGUAGGAGCGUGGCUUCUGGAGCUAGACCACAUGGGUUCAGAUCCCAGCGGUGCCUCUAACUGGCCACAGGACCUUGGGCAGUCAGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Relationships

Molecular Relationships

Expression Publications