v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) GRTP1 antisense RNA 1 (GRTP1-AS1) URS000075D94B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

GRTP1-AS1: GRTP1-AS1 is a gene that has been studied in the context of various conditions, including sciatica. It is an antisense RNA gene [PMC7877113]. qPCR validation of microarray data showed that the expression levels of GRTP1-AS1 decreased [PMC6008930]. The TC-associated eQTLs at the GRTP1-AS1 locus influenced the expression of multiple genes, including GRTP1-AS1 itself [PMC9553944]. Integrated traditional Chinese medicine (TCM) treatment was found to alleviate sciatica and downregulate the expression levels of GRTP1-AS1 in peripheral blood compared to baseline [PMC7877113]. However, the specific role of GRTP1-AS1 in sciatica or in relieving sciatica is currently unknown [PMC7877113]. In summary, GRTP1-AS1 is an antisense RNA gene that has been found to have decreased expression levels in various conditions, including sciatica. The TC-associated eQTLs at this locus influence the expression of multiple genes, including GRTP1-AS itself. Integrated TCM treatment has been shown to alleviate sciatica and downregulate the expression levels of GRTP1-AS in peripheral blood. However, further research is needed to understand the specific role of GRTP1-AS in these conditions [PMC6008930] [PMC9553944] [PMC7877113].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CGCUGACCAAGUGCCAGGCCUCACUGAAGCUGACCUCCGCGUUAACCCUGGACACAAGCCGAGCAGGAAGGAUAAUGCCGGCUUGACAACUCCACUGGUUUCUGCUCCCACUGGCCCUACCUCUGUUAGAGGUGUUCGCCAGGCACCCCAUGCGGUCACCAGCAGACAGCCGCUUUCUGCACAAGUUCCAAGAUGGACUCACAGCAGUCCCCGCCAGCCAUGACGCUGAGAUGGGUGUACACCCAGCUCUGGAGGAACCCAACCGCCUGUGGUCUCUCCACAACGGCUGCAAAAUACUGCUUCAGUUUUGAUUCUUUCAUGGAGGAAGACGUAACUUCAAGUUAAAAGCAGCAGGCGCACCGCUCACCCCUGGACGCUGAGGCUAGACACUGGGUGGAAACCGGUUCCUUCCGGCCCCCGGGCCCUGCACCAGAGCUCGACCCCCACCGCCUCACCUGUCCUGAUGGCGUCCUCCAGCCUGGGGUUUCUCUCUCCCUGGAGAAGCUGGUGGUAGUAGCCGGGAUUCUGGUCCAUCUGCGCCUGGGCCCCACUCAGCACCAUCCAGACGCGGGCACGGUGCUCCAGCGGGACCCCUUUCCGGACAUAGCGCUUCACUGAAGGCCGAGAGGACGGACAGCGUGUGAGCUGGACCAGGGGCCUGCGGGGCCCACGCGUUCCUGCCACACUUUCCACUCUCACCAGUUCUCUUCUUAAAUCAAAUAUUAAAGAGACCCAGAACUUCGUCCAUCUCCACCAAAACUGGUACAUAUACUCCUUUAAAAAUUCUGCUCUCCUCUCCCUCUCAACAGAGCACAAACCAGACUGGCUACAGAACCGCCCCCACGCCCACUUCACCAUUCAAUGCAGGUGGUCAAGAAACAGAGCCGCGGUCAGAUGGCUGCUCUGCAAAGCUUCCUGGCAGCCGUGCAGAGCAGCAGCAAAGGGGCAAAGCAGUGAGAGGCCCAGCUGAGUACAAGGAGGCCGGCUGGGCUCAGCUGUGAGCACCUCAGGUGGGACGCCACAGCUGGGAGAACACGGUUUCAGUGGCAGACGUCACUGUCCAACUCGUGCAGUUAAUCUCUAUAUAUUGAAAGCUACUCCAUUUUGUAGGGAUAUUUUAAUUGACAAUAAAAAUGUGAAAAAGUAAUUAGUAAUUUUAAUGGCCACAGAAACAUAUAGGGACAGAAAGAAGCCAAAAGCCAUGAGCUAUCUUCAUUAGUCAAUACUGAGUAAUUUCUUAGGCAGAUGGAAAAGAUUCUCCGCUGUAACCAACCUCCAGGUCACAGCCACAGGACUUCCCACGGACUUCCCCUGCUCUUAAAGCAAACUGCAGAACCAAGCGUGGACUUCUGCUCCUGAGGGGGACGGAAGGACAGUCCCCUGCGGUCAUCUCUAUAGGAGAUGGGGGCCAUGGGUGGGAGAGAAACUCCCUGUUGCACUUUGUAGCCCUCAGUAUGAUUAAAGUGUUUACCAUGUACAUAAAUUAUGCUUUUUAAGUUCACAUGUCUUAUAUACUUUUACGUUACUUUUUAAAAUUAAAAGACAGUUAACUUUUAAGAAUAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications