v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1356 (LINC01356) URS000075D770_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01356: LINC01356 is a long non-coding RNA (lncRNA) that has been studied in relation to cancer [PMC8810060]. In a study, a risk score was computed for each patient using a formula that included the expression levels of various lncRNAs, including LINC01356 [PMC8810060]. The study found that upregulation of LINC01356 was associated with shorter recurrence-free survival (RFS) time in patients [PMC8810060]. Additionally, silencing LINC01356 was found to significantly inhibit the invasion ability of a lung cancer cell line in an in vitro blood-brain barrier (BBB) model [PMC9092220]. These findings suggest that LINC01356 may play a role in cancer progression and invasion [PMC9092220]. Further research is needed to fully understand the mechanisms and potential clinical implications of LINC01356 in cancer.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AUUUACAAAAUGUUCAUGGCAGGGCCCACUUCACAGGGCUGUGAGGAUUACAGAGGAUAAUCUGGGUGAGGCGCAUCAGCCCCAGCGCCGCCUGCCACAAUUCUAUCCGGCCCCACAUAUGCAUCGUCCAUAAGCGUCCGGCCCCUGCAUUCUCGCUUUUCCACGUGGCCGAGGUGCACACCCCAACCCACUGGGCCAGUCUCCCCGCCCUCUUACCUGCUCUUCUUUCCCGACUCGUCUUUAAUACCCACCAGGAGCCAGUCGCCGCGGGCCUGGCUCUGUGGUGGCAAGUUGCAUGGGUUCUCCCAUCAGGACCUCCCGAUGAGCCUACGAGGUCGGUUCUAUUACUGUCGCCACUUCAGAGGGAGGAAACAGGCCCGCAGGGUUGGGGAACUUCCCGAGGUCACUGAACUGGUGUCAGGCCCAGAUUGGAAUCCAAACACAUCCCAGCCCAUGCCCGGCUCCCCAGCGCCGGCUCCCAGGCGUCUUCCCGGGUGCCAGCGGCACCCGCAUCCAUUCAAAUGCUGCCCAGUCCCCGCUCCUCAGUCGCUUCCCUCUACUACGCGCCCGCAUCUCCCCCCGACCCCUCAGGGUCAGGCCUCUCGGUGGCUUUUCCUUUUUCUCUUCCAGAAACUAAGGGGUGAGACCGACGUUUGUGUGCCGGACGCGUGCAGGUGGCGGCGACGCUCCCGGGAGACGCGGGGGGAGAACCAGUCUGUGCGCGCGGCUGUGAGAAGCCCCGACCAAGCUUUCCACGCGCUUGUUUCGGGCAGCAGAGGACGCGAGGGCCGACUGCGUCCCCAGUGCGCAGGCUCGGCCGGGGGCGCGUAAUCAGGCAGCCCAGCGGUCCCUUCAAACCGAGGCAGGGAAGCUCUACGUCUUGGGGGCCGCAUGGUGCCGAGAGCGCAGACCAGACCCGCCCCGCCUCUCCGUGCCACGCACGCGCUCGGCUCCGCGCUUAAUGGCUGGAGUGCAGUGGCGCGAUCUCGGCUCAUCGCAACCUCCAUCUCCCGGGUUCAAGCAAUUCUCUGCCUCAGCCUCCCGAGUGGCUGGGAUUACAGAAGCAGUAUCUGACUGUGUUGCCCAGGCUGGUCUUGAACUCCUGGUCUCAAAUGAUUCUCCUGCUUUGGCCUCCUAAAGUGCUGGGAUUACAGACAUAUUUAUUCAAUUUUUAAUGUCAGACCAUAAGCAACGCGAAUGAAAUUUGGUGCCAUCACUCGGAUCAGGGGACCUCCCUUGGGAGAUCAAUCCCCUGUCCUCCUGCUCUUUGCUCCAUGAGAAAGAUCCACCUACGAUCUCUGCUCCUCAGACCAACCAGCCCAAGGAACAUCUCACCAAUUUUAAAUCGGAUCUUCUCAGCUUAGCGGCUGAAGACUGAUGCUGCCAGAUGACUUUGGAAGCCCCCUGGACCAUCACAGAUGCCCAGCUUUGGAUAACUCUUACAGUGGAGGAAGACAGGAAUAUCAGGUCUCUGAGCCCAAGCUAAGCCAUCAUAUCCCCUGUGACCUGCAUGUAUGCAUCCAGAUGGCCUGAAGUAACUGAAGAAUCACAAAAGAAGUGAAAAUGGCGCGUGCCUGCCUUAACUGAUGACAUUACCUUGUGAAAUUCCUUCUCCUGGCUCAUCCUGGCUCAAAAGCUCCCCCACUGAGCACCUUGUGACCCCCACUCCUGCCUAACAGAGAACAAUCCCCUUUGACUGUAAUUUCCCACUACCUACCCAAAUCCUAUAAAACGGCCCCACCCCUAUCUCCAUUCACUGACUCUUUUUGGACUCAGCCCACCUGCACCCAGGUGAAAUAAACAGCCUUGUUGCUCACACAGAAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications