Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-4686 precursor URS000075D716_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR4686: MIR4686 is a microRNA that was found to be one of the most upregulated miRNAs compared to healthy controls in a study [PMC8898099]. It was identified as one of the 11 miRNAs in the studied population [PMC8898099]. A meta-analysis of data from non-Japanese ethnicities revealed that a SNP locus near MIR4686 was associated with the disease after Bonferroni's correction [PMC4738362]. This locus was found to be located upstream of KCNQ1 and not in linkage disequilibrium with another lead SNP within the KCNQ1 locus [PMC4738362]. Additionally, MIR4686 was identified as a common susceptibility locus for type 2 diabetes across different ethnicities, although the significance of the association varied among individual ethnic groups [PMC4738362]. Furthermore, in publicly available European GWAS data, the T2D risk allele at the MIR4686 locus was associated with an increase in fasting plasma insulin, although this association did not reach statistical significance [PMC4738362]. Overall, MIR4686 is an upregulated microRNA that has been implicated in type 2 diabetes and its association with fasting plasma insulin levels has been investigated [PMC8898099] [PMC4738362].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCUUCCUGUAUCUGCUGGGCUUUCUGGUGUUGGCAGCCCAAGAUGACACCCUGGGCCCAGCAGGAGCCAGAAGCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

Publications