v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 370 (ENSNLEG00000022748.2) secondary structure diagram

Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 370 (ENSNLEG00000022748.2) URS000075D5FE_61853

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGACAGAGAAGCCAGGUCACGUCUCUGCAGUUACACAGCUCAUGAGUGCCUGCUGGGGUGGAACCUGGUCUGUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

  1. Gorilla gorilla gorilla microRNA 370 (ENSGGOG00000032174.2)
  2. Macaca mulatta microRNA mml-mir-370 precursor
  3. Macaca nemestrina (Pig-tailed macaque) miRNA (ENSMNEG00000003534.1)
  4. Otolemur garnettii miRNA (ENSOGAG00000017327.1)
  5. Pan troglodytes miRNA
  6. Rhinopithecus bieti miRNA (ENSRBIG00000009772.1)
  7. Rhinopithecus roxellana miRNA (ENSRROG00000003917.1)
 2D structure Publications