Echinops telfairi (small Madagascar hedgehog) microRNA 140 (ENSETEG00000022339.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Echinops telfairi (small Madagascar hedgehog) microRNA 140 (ENSETEG00000022339.1) URS000075D203_9371

94 nucleotides
1 database (Ensembl)
Found in 13 other species
95 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

UCUCUCUGUGUCCUGCCAGUGGUUUUACCCUAUGGUAGGUUACGUCAUGCUGUUCUACCACAGGGUAGAACCACGGACAGGAUACCGGGGCACC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

Bos taurus microRNA bta-mir-140 precursor
Erinaceus europaeus (western European hedgehog) microRNA 140 (ENSEEUG00000016177.1)
Loxodonta africana (African savanna elephant) microRNA 140 (ENSLAFG00000024575.1)
Myotis lucifugus microRNA 140 (ENSMLUG00000017884.1)
Otolemur garnettii (small-eared galago) microRNA 140 (ENSOGAG00000025743.1)
Ovis aries miRNA (ENSOARG00000024873.1)
Prolemur simus microRNA 140 (ENSPSMG00000012931.1)
Pteropus vampyrus (large flying fox) microRNA 140 (ENSPVAG00000025831.1)
Spermophilus dauricus miRNA (ENSSDAG00000024212.1)
Tupaia belangeri microRNA 140 (ENSTBEG00000018020.1)
Tursiops truncatus (bottlenosed dolphin) microRNA 140 (ENSTTRG00000022893.1)
Urocitellus parryii microRNA 140 (ENSUPAG00010023765.1)

Publications