Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-3609 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-3609 precursor URS000075D1DB_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mir3609: MIR3609, a microRNA, has been identified as a potential biomarker for locally advanced breast cancer due to its downregulated expression [PMC9818474]. It contributes to the immune response against breast cancer by inhibiting the PD-L1 immune checkpoint, potentially enhancing the effectiveness of immune-mediated tumor cell clearance [PMC7527443]. MIR3609 can also bind to the 3′ UTR region of PD-L1 mRNA and reduce its expression, which may sensitize breast cancer cells to the chemotherapeutic agent doxorubicin [PMC9713762]. While the downregulation of MIR3609 and its precursor in cells with inhibited kalirin–GEF1 has been observed, it implies a regulatory mechanism that may lead to the upregulation of their target genes, which are involved in processes such as cell morphogenesis and neuron differentiation [PMC8017594, PMC9727336]. Moreover, the upregulation of MIR3609 has been associated with increased sensitivity of breast cancer cells to Adriamycin, which is synonymous with doxorubicin [PMC9727336].

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUAACAGUAACUUUUAUUCUCAUUUUCCUUUUCUCUACCUUGUAGAGAAGCAAAGUGAUGAGUAAUACUGGCUGGAGCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Gorilla gorilla gorilla microRNA 3609 (ENSGGOG00000039794.1)
Relationships

Molecular Relationships

2D structure

Loading 2D structure...

Expression Publications