Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-634 URS000075CE29_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-634: Hsa-mir-634 is a microRNA that is up-regulated in atrial fibrillation and coronary artery disease [13,42]. It has also been found to be involved in heart remodeling in patients with idiopathic dilated cardiomyopathy [43]. Another microRNA, hsa-mir-520h, is expressed in human heart disease [44]. Hsa-mir-450b-3p is regulated by ischemia [45]. TLR2 has been identified as a critical regulator in acute myocardial infarction (AMI) and a potential biomarker for AMI detection [46–48]. Blocking the NFKBIA-mediated NF-κB signaling pathway has shown to protect against myocardial infarction (MI) [49]. High levels of ADM are related to impaired left ventricular function and death in patients with AMI [50–52] [PMC8863347] [13] [42] [43] [44] [45] [46–52]. In addition, hsa-mir-634 has been found to be common between the targeted miRNAs of circCOL1A1 and the differentially expressed miRNAs [PMC8960148]. It is also common between the targeted miRNAs of circCEACAM5 and the differentially expressed miRNAs [PMC8960148] [PMC8960148]. Hsa-mir-634 has been found to be downregulated in osteoarthritis [PMC4366666], while it is upregulated in non-small-cell lung cancer pathway and pancreatic adenocarcinoma tumor groups compared to normal groups [PMC3091682] [PMC9669652] [PMC4366666] [PMC3091682] [PMC9669652]. In summary, hsa-mir-634 plays a role in various cardiovascular diseases such as atrial fibrillation, coronary artery disease, dilated cardiomyopathy, ischemia, acute myocardial infarction (AMI), and myocardial infarction (MI) [13,42,43,45,46–52]. It also shows differential expression patterns in osteoarthritis [PMC4366666], non-small-cell lung cancer pathway, and pancreatic adenocarcinoma [PMC3091682] [PMC9669652].

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AACCAGCACCCCAACUUUGGAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Pan troglodytes ptr-miR-634
Publications