v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1497 (LINC01497) URS000075CD1C_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01497: LINC01497 is a long non-coding RNA (lncRNA) that has been identified as one of the eight lncRNAs with significant prognostic value in predicting patient survival probability [PMC9524933]. It has also been reported that LINC01497, along with seven other lncRNAs (AP000487, AC011997, LINC01592, LINC01711, FENDRR, AC087045, and AC137770), can serve as a prognostic biomarker for esophageal squamous cell carcinoma [PMC8877069]. A risk score formula for overall survival (OS) has been identified for this signature, with the expression levels of AP000487, AC011997, LINC01592, LINC01497, LINC01711, FENDRR, AC087045 and AC137770 contributing to the score [PMC7053640]. Furthermore, these eight lncRNAs have been selected to build a prognostic signature specifically for esophageal squamous cell carcinoma [PMC7053640]. In addition to its prognostic value in predicting patient survival probability and risk score for OS in esophageal squamous cell carcinoma patients [PMC9524933] [PMC7053640], LINC01497 is also one of the eight hub genes that may offer novel therapeutic strategies for patients with esophageal squamous cell carcinoma [PMC9109328]. The risk coefficient analysis suggests that LINC01497 is a risk factor for esophageal squamous cell carcinoma [PMC9109328].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCUGCAAGACACCCUGCUUCUGGCUCUGAGCUUUGCUUGUCUUCAGGGAUGGAGCCCCUCCCAAGGCAAGUUCAACUGGGUUCUUUGGCAGCCGAAGUCUACACGGACCCUGCAGGGAGCGGUGGAGAAAAGUUAGAUGUCUGAAGUGUUUUUCAUUGGACCAAAAUCAAGGUGUUGGCUGGGCUACCUUCCCUUCUGGAGACUCUAAGGAAGAAUCCAUUUCCUUGUCUUUUCCAGAUCCUAGAGGCUACCUGCAUUCCUUGGCUUUUAUCCCCAAUCUUCCAUCUUCGGAGCCAGCAACACACCUUUUUCUUCCUUCCAUGAUAUAGAUAUAUUGAUCAUGAGGAGAGGGCUCACCCCUCACCCGGAGAAGUAGUUGGGGAAGCAAUAUGCGGAAACAAAGCCAUGAAUCUGACAAGAAAUGUACUUAAGAUUGUAUAUAUGGAGAUGAAUACCCAUUGUCCUUUGCACUUUCUGGAUGAUAAAUUAGAAAAGAAAAAUCCAAAGAAUGAAGUUGUGCUAUUUGUCCUCACUUCUGAUUUGGGAAACUAGAGGAAAUUAAGAUGGGAAAAGACCAUGUGAGGACACAGUGAGAAGGAGACCAUAUGCAAAGCAGGAAGGAAGAUCUCACUGGAACCAAAAACCAGCCCUGCUGGCACCCUGAUCUUGGACUUCUAGCCUUUCUCAGAACUGUGAGAAAAUAAAUUUCUGAUGUUUCAGCCACUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications