v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Amazona collaria (yellow-billed parrot) miRNA (ENSACOG00000001731.1) secondary structure diagram

Amazona collaria (yellow-billed parrot) miRNA (ENSACOG00000001731.1) URS000075CB0E_241587

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
ACAUACUUCUUCAUAUGCCCAUAUGGAGUCGGCCGGCGUUAUGGAAUGUUAAGAAGUAUGUAUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

  1. Chrysolophus pictus miRNA (ENSCPIG00010010885.1)
  2. Coturnix japonica (Japanese quail) miRNA (ENSCJPG00005017088.1)
  3. Gallus gallus microRNA gga-mir-1b precursor
  4. Meleagris gallopavo (turkey) miRNA (ENSMGAG00000000141.2)
  5. Melopsittacus undulatus (budgerigar) miRNA (ENSMUNG00000007358.2)
  6. Numida meleagris miRNA (ENSNMEG00000006397.1)
  7. Phasianus colchicus miRNA (ENSPCLG00000007493.1)
 2D structure