Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-3941 URS000075CA3B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-3941: Hsa-mir-3941 is a microRNA that targets the 3ʹUTR of the SOCS3 mRNA, which is a potential mechanism for interfering with viral expression [PMC8527307]. Transfection studies with hsa-mir-3941 have shown a significant reduction in SOCS3 mRNA levels, suggesting that this microRNA could play a role in the regulation of this gene [PMC8201247]. The therapeutic potential of hsa-mir-3941 includes not only the direct targeting of viral mRNA but also the possible inhibition of the PI3K/AKT pathway, which could lead to reduced viral infection [PMC8201247]. Despite its low prevalence in GISAID deposited sequences, hsa-mir-3941 does not have its binding affinity affected by mutations within these sequences, as predicted by IntaRNA and RNAhybrid tools [PMC8201247]. The collective insights from bioinformatics and gene reporter assays indicate that hsa-mir-3941 could be instrumental in diminishing viral pathogenicity for significant variants of SARS-CoV-2 and potentially SARS as well [PMC8201247].

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUACACACAACUGAGGAUCAUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Relationships

Molecular Relationships

Publications