Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-3941 URS000075CA3B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-3941: Hsa-mir-3941 is one of the CoV-tar-miRNAs that target the 3ʹUTR of the SOCS3 mRNA [PMC8527307]. Transfection with hsa-mir-3941 mimic resulted in a statistically significant reduction in viral expression [PMC8201247]. The therapeutic upregulation of hsa-mir-3941 may be beneficial in reducing viral infection by directly blocking viral expression through 3ʹUTR targeting and inhibiting the PI3K/AKT pathway [PMC8201247]. The mutation in hsa-mir-3941 is rare and does not affect its binding affinity with other microRNAs [PMC8201247]. Hsa-mir-3941, along with hsa-miR-138-5p, has the potential to reduce viral pathogenicity in major variants of SARS-CoV-2 and SARS [PMC8201247].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUACACACAACUGAGGAUCAUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications