Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-574 URS000075C92B_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-574: Bta-mir-574 is a microRNA that has been associated with a bacterial cluster comprising Prevotella, Bacteroides, Ruminococcus, Propionibacterium, and Klebsiella [PMC6708143]. It has been found to affect lactation and mammary gland development through its interaction with the leptin receptor [PMC6258393]. However, the expression of bta-mir-574 in the HM or LM fraction was only partially consistent with previous studies [PMC5209821]. Bta-mir-574 is also involved in the regulation of AURKA and other candidate differentially expressed genes (DEGs) [PMC6213350]. In addition to bta-mir-574, other miRNAs such as bta-miR-3432a, bta-miR-2285e, bta-miR-197, and bta-miR-2284y have been identified in the cellular fraction [PMC9783024]. Bta-mir-574 is one of 13 highly abundant miRNAs that have been identified in lactating mammary gland tissue [PMC5472319]. It has also been found to regulate the expression of target genes involved in mammary gland biology during lactation [PMC5414302]. Specifically, bta-mir-574 may play an important role in milk ingredient transport and synthesis through its regulation of LEPR in the adipocytokine signaling pathway [PMC5414302]. Furthermore, studies have suggested that bta-mir-574 controls the development and lactation of mammary tissue in dairy goats through its regulation of leptin receptor [PMC9029867].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGUGUGUGUGUGUGAGUGUGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications