v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) family with sequence similarity 99 member B (FAM99B) URS000075C1A3_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

FAM99B: FAM99B is a long non-coding RNA (lncRNA) that has been found to be associated with the prognosis of hepatocellular carcinoma (HCC) patients [PMC7744744]. It is one of the seven lncRNAs that showed a significant association with the prognosis of HCC patients [PMC7744744]. FAM99B has been reported to inhibit cellular proliferation, migration, and invasion in HCC [PMC10116027]. It also showed a high degree of expression consistency with FAM99A, another family member [PMC10116027]. FAM99B is downregulated in HCC and may play inhibitory effects on the development of HCC [PMC8802422]. Its low expression is associated with poor prognosis in HCC patients [PMC7373802]. Knockdown of FAM99B expression significantly inhibits the proliferation, migration, and invasion of HCC cells [PMC9609286]. FAM99B has also been found to be hypermethylated in HCC cells and its methylation status can be confirmed through targeted bisulfite sequencing [PMC9102946]. The upregulation of FAM99B suppresses HCC progression and its low expression is associated with advanced histologic grade, T-stage, and vascular invasion in HCC patients [PMC7152554][PMC8364386].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGGGCUGCAGGCACUCCUGGGAGCAGGAGGAGGGUGGCCUGUCCUGGGCAGACCAGCCUCUCUGGGCUGUGUGGCCCCAGCUCCCUGAGCCCAGAGGGAGGUGAGGGUGAGAAGGCCUGGACCAGGCAGGACGCAGCCCCCAGGGCCCCUGCUGGGAAGAGGUCAGAACCUCCCAAGGACCCAGAAGGCCAGAACACACUAGAGGGUCCCGGCAUCCUGAUGAGUCCACUGUCCCCGCGAUGGUUUUCAGGGAUGGAGAAGGCUCCCUGUCCUCCGCUGGAACCCUGCAGCCGGGCUGACGAGACCCCAGCGAGACCUGCAGAACAUUACAGCAGAAUGAAGGAGAGCCAGAGGAAGAGGCAGAUGUGCUGGCCUGUAAACAGUCUGAUUUCCAAUGUAAACCAGAUUCAGGCCCACGACAUCAGGUAAACAUCUGCAUCAGAGCCCCCGGCCCCCCACCGCCCGGGAGGCCCCGGGGUCCACACGGCCGACUCUGGGACCCGUCACAGUGACCGCCGAGACAUUUCGUAAUUAGGCAAAAUUGAUCCUUGCAUUCCUUCCCUAAAUCCCAAAUCUCUGCAAUUUUACUUCUUCUCAAAAAUGAAAACAUUUGGCAAUUAGCUGAUCCAAGUGAAAAAGGUAGAGAAUGUGCUCUCAACUGGAAAAUGCCAAUUAAGGAAGCAGCUCUGACUUCCCACCCGCCCUGGCUAAGCUGGGAGCUUAUCUUCCCCGAGAAGAAUCUGCUGGGAUAAGGGGGCUUGGGAAACACCGAGGGCAGGGCUGCCUCCUCACCUCCUCAGCUUCCUCUGAGAGCAGAUUAGCCGUGGCCUUGUGCCAGCAGGGCCUGGGUGCCACACCGGGUGGCAGCGGGUGGCAGAGCCGGGCCCCGCUCCGGCACUGGGAUUUGGGGUGGCGGGACCCAGUGGGGCACCCGCUUGUGGGCAGCACUGAGGGCGGUGACGUAGGCAGCGGGUGCCGGUGUCUGCCCCUCCAUCUGGCCGGGCUCCCCACCCUGCUCCUGCAGCCCUGGACCUCAGGGCCCAUUUGCGGUGCAAGGCGGCUCUUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications