v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-193b precursor URS000075BAEB_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR193B: Previous work demonstrated that MIR193B acts as a tumor suppressor in the hematopoietic system and that it can induce apoptosis and G1/S-phase arrest in various human Acute Myelocytic Leukemia (AML) subgroups [1]. According to the human genome (GRCh38/hg38, UCSC Genome Browser), MIR193BHG (MIR193B host gene) is located on human Chr16 and exhibits high sequence conservation among species [2]. References: 1. [PMC7273449] 2. [PMC9779864]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GUGGUCUCAGAAUCGGGGUUUUGAGGGCGAGAUGAGUUUAUGUUUUAUCCAACUGGCCCUCAAAGUCCCGCUUUUGGGGUCAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

  1. Cercocebus atys microRNA 193b (ENSCATG00000011976.1)
  2. Chlorocebus sabaeus (African green monkey) microRNA 193b (ENSCSAG00000021986.1)
  3. Colobus angolensis palliatus miRNA (ENSCANG00000006620.1)
  4. Gorilla gorilla gorilla microRNA 193b (ENSGGOG00000029193.2)
  5. Macaca fascicularis microRNA 193b (ENSMFAG00000005584.2)
  6. Macaca mulatta microRNA mml-mir-193b precursor
  7. Macaca nemestrina (Pig-tailed macaque) microRNA 193b (ENSMNEG00000014082.1)
  8. Mandrillus leucophaeus (Drill) microRNA 193b (ENSMLEG00000023440.1)
  9. Pan paniscus (bonobo) microRNA 193b (ENSPPAG00000015507.1)
  10. Pan troglodytes ptr-mir-193b (ENSPTRG00000032181.2)
  11. Papio anubis microRNA 193b (ENSPANG00000002768.3)
  12. Piliocolobus tephrosceles (Ugandan red Colobus) miRNA (ENSPTEG00000021918.1)
  13. Pongo abelii miRNA
  14. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-193b precursor
  15. Theropithecus gelada (gelada) microRNA 193b (ENSTGEG00000025220.1)
 Publications