Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) RNA, U5A small nuclear 1 (RNU5A-1) secondary structure diagram

Homo sapiens (human) RNA, U5A small nuclear 1 (RNU5A-1) URS000075BAAE_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

RNU5A-1: RNU5A-1 is a non-coding RNA gene that has been mentioned multiple times in the provided text [PMC5568388] [PMC6467950] [PMC7272712] [PMC9467413] [PMC9803687] [PMC9194484] [PMC7610016] [PMC5587755] [PMC5137419]. It is not a small nucleolar RNA (snoRNA) and its involvement in various cellular processes is not mentioned in the provided context. In the low IA ancestry group, RNU5A-1 was identified as one of the unique genes [PMC5568388]. It was found to be differentially expressed between R. conorii and R. montanensis-infected cells [PMC6467950]. In a network analysis, RNU5A-1 was identified as one of the splicing factors associated with survival-associated alternative splicing events [PMC7272712]. In another study, RNU5A-1 was excluded from the training cohort but found to be associated with alternative splicing in patient outcomes of endometrial cancer and colon cancer [PMC9467413] [PMC9803687]. Additionally, RNU5A-1 was found to be downregulated in G1 and G2 samples compared to control samples [PMC9194484]. The gene also plays a role in snRNA processing and has been studied in relation to INTS11 depletion [PMC7610016] [PMC5587755]. The binding of rp eS1 protein to RNAs transcribed from the RNU5A-1 gene has been observed, suggesting its involvement in splicing processes with U11 snRNP and U5 snRNP [PMC5587755]. The accumulation of extended forms of U4atac (RNU4atac) and U5 (RNU5A-1) snRNAs has also been observed under certain conditions [PMC5137419].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUACUCUGGUUUCUCUUCAGAUCGCAUAAAUCUUUCGCCUUUUACUAAAGAUUUCCGUGGAGAGGAACAACUCUGAGUCUUAACCCAAUUUUUUGAGGCCUUGCUUUGGCAAGGCUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications