Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Amazona collaria (yellow-billed parrot) microRNA 29a (ENSACOG00000008435.1) secondary structure diagram

Amazona collaria (yellow-billed parrot) microRNA 29a (ENSACOG00000008435.1) URS000075B9EB_241587

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACCCCUUUAGAGGAUGACUGAUUUCUUUUGGUGUUCAGAGUCAAUAAUAUUUUCUAGCACCAUUUGAAAUCGGUUAUAGUGAUUGGGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 25 other species

  1. Accipiter nisus (Eurasian sparrowhawk) microRNA 29a (ENSANIG00000009897.1)
  2. Apteryx haastii miRNA (ENSAHAG00000011623.1)
  3. Apteryx owenii (little spotted kiwi) microRNA 29a (ENSAOWG00000003492.1)
  4. Apteryx rowi (Okarito brown kiwi) microRNA 29a (ENSARWG00000001120.1)
  5. Aquila chrysaetos chrysaetos microRNA 29a (ENSACCG00020003325.1)
  6. Athene cunicularia (burrowing owl) microRNA 29a (ENSACUG00000003488.1)
  7. Bubo bubo (Eurasian eagle-owl) miRNA (ENSBOBG00000002648.1)
  8. Buteo japonicus (eastern buzzard) miRNA (ENSBJAG00000012278.1)
  9. Calidris pugnax microRNA 29a (ENSCPUG00000000192.1)
  10. Calidris pygmaea microRNA 29a (ENSCPGG00000016808.1)
  11. Chrysolophus pictus microRNA 29a (ENSCPIG00010001185.1)
  12. Coturnix japonica (Japanese quail) microRNA 29a (ENSCJPG00005004157.1)
  13. Dromaius novaehollandiae (emu) microRNA 29a (ENSDNVG00000010769.1)
  14. Gallus gallus microRNA gga-mir-29a precursor
  15. Lepidothrix coronata microRNA 29a (ENSLCOG00000010283.1)
  16. Manacus vitellinus (golden-collared manakin) miRNA (ENSMVIG00005019819.1)
  17. Meleagris gallopavo (turkey) microRNA 29a (ENSMGAG00000000268.2)
  18. Melopsittacus undulatus (budgerigar) miRNA (ENSMUNG00000011366.2)
  19. Nothoprocta perdicaria microRNA 29a (ENSNPEG00000002205.1)
  20. Numida meleagris microRNA 29a (ENSNMEG00000001534.1)
  21. Otus sunia (Oriental scops-owl) miRNA (ENSOSUG00000014585.1)
  22. Phasianus colchicus microRNA 29a (ENSPCLG00000014598.1)
  23. Strigops habroptila microRNA 29a (ENSSHBG00005002223.1)
  24. Strix occidentalis caurina miRNA (ENSSOCG00000000252.1)
  25. Struthio camelus australis (African ostrich) microRNA 29a (ENSSCUG00000012130.1)
2D structure