Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-423 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-423 precursor URS000075B951_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR423: MIR423 is one of the 16 candidate miRNAs that have been studied for their potential involvement in diabetes [PMC7463887]. It is a type of miRNA that has been found to be altered in the plasma/serum of diabetic patients [PMC7463887]. In a study involving 47 T2D patients and 22 healthy subjects, the expression of MIR423, along with other miRNAs such as mir29a, mir34b, Xpo5, and several others, was found to be significantly different in leukoplakia tissues compared to control tissues [PMC4035900]. However, the expression of these genes was not modulated by genotypes at SNPs [PMC4035900]. This study aimed to investigate the potential involvement of these candidate miRNAs in diabetic retinopathy [PMC7463887]. The researchers analyzed plasma/serum samples from T2D patients with and without retinopathy as well as healthy subjects [PMC7463887]. The findings suggest that MIR423 and other miRNAs may play a role in the development or progression of diabetic retinopathy [PMC7463887]. Further research is needed to fully understand the mechanisms by which these miRNAs contribute to the pathogenesis of diabetes and its complications [PMC7463887].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUAAAGGAAGUUAGGCUGAGGGGCAGAGAGCGAGACUUUUCUAUUUUCCAAAAGCUCGGUCUGAGGCCCCUCAGUCUUGCUUCCUAACCCGCGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

2D structure Publications