v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) HID1 antisense RNA 1 (HID1-AS1) URS000075B87B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

HID1-AS1: HID1-AS1 is a long non-coding RNA (lncRNA) that has been associated with several protein-coding genes in breast cancer (BC) [PMC8902307]. These genes include PDE2A, EBF1, BTNL9, LDB2, and CD300LG [PMC8902307]. HID1-AS1 has been identified as a potential diagnostic biomarker for BC [PMC8902307]. It is considered a risk factor for BC based on hazard ratio analysis [PMC8902307]. HID1-AS1 is downregulated in BC samples compared to normal samples [PMC8902307]. It may be involved in various signaling pathways such as neuroactive ligand-receptor interaction, AMPK signaling pathway, PPAR signaling pathway, and cGMP-PKG signaling pathway [PMC8902307]. HID1-AS1 could be used as a diagnostic marker for BC based on its expression levels in BC cells compared to normal cells [PMC8902307]. The stemness-index-related lncRNA signature based on HID1-AS1 has been shown to predict the survival of BC patients effectively [PMC8902307]. HID1-AS1 is related to the prognosis of BC patients and its expression levels are correlated with several protein-coding genes [PMC8902307].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GUUCUGCCUGUCUACUGCCCAAGCCACACCCUGUAAGAGCCUGGAACCACAUAUCAUCCUAUGGACAACUGGCCUGAAUCUCCUUGGGGACUCCAAGUGGUAAGACAGGAUCUUGCUACAUUGCCCAAGCUAAUCCCCAACUCCUGGCCUCAAGGGAUCCUCCCACCUCAGCCUCCCGAAGUGCUGGGAUUACAGAUGUAAGCCACCAUGCCUGGCCCCUAGAUGCUUCAAAAGGAUGUGACAUUCACUUAAAGAGGAAUUCUACAGUUUUUUGAGACAGGGUCUCCCUCUGUCAUUCAGACUGUGCAGUGGCAUGAUCACAGCUCAUUGCACCCUCUACCUCCAAGGCUCAAGCAAUCCUCCCACCUCAGCCUCCCAAGUAGCUGGCAUUACAGGUGCACACCAUGACGCCCGGCUAAUUUUGUAUUUUUUAUACGGAUGGGGUUUUGCCAUGUGGCCCAGGCGGUCUCAAACUCCUGAGCUCAAGCGACCCUCCUGCCUGGGCCUCCCAAAGCAUCGGGAUUACAAGCAGGAGCCACCGUGCUCAGCCUUCAAAAAGAAGAAAAAAUAAUAAAGGCAAGUGAAGGUAUGAAGAAGGAGGAGGAGAAGAAGGAGAAGAAAAGAAUUGAGAACUCUUGCUAACCAGCCACUCCGGGUGAAAUUUUGACCCCUUUGGUCUUGCCCAUCACUCAGAGCCAUUUCUGUGGCUUGCAACCAGGAACUCCCAAGUGACAUGGAAAUAUUACUGGAUUUAAUUGAGUCCACCCUCACCUAGCCUCAGGGGCUCUUCUACCACUCAGAUGGGCAUUCUCCUCCAUAGAUCAUCUUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications