Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-620 URS000075B716_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-620: Hsa-mir-620 is a microRNA that has been studied in various contexts. The variant T allele of rs241456 has been found to increase the minimum free energy (MFE) of binding for hsa-mir-620 compared to the common C allele [PMC9692299]. Hsa-mir-620 has been implicated in the silencing of over 100 target mRNAs [PMC3375551]. It has been suggested that a 63-nt fragment released from SncmtRNA-1 acts as a "sponge" to trap hsa-mir-620 and relieve its negative effect on the expression of PML mRNA [PMC3375551]. Hsa-mir-620 is highly complementary to a 63-nt fragment and is connected to other miRNAs in an interaction network [PMC8798919]. It has also been identified as one of the top miRNAs for sponging by circEPS15 and circ_PTN [PMC8861492] [PMC8607136]. Hsa-mir-620 is differentially targeted by nine miRNAs depending on the allele, including hsa-miR-1270, hsa-miR-522, and hsa-miR-124 [PMC3559822]. It has also been identified as one of 16 candidate miRNAs for gastric cancer diagnosis [PMC7882724]. Analysis showed that hsa-mir-620 had 11 repeats and was unaltered in microsatellite instability (MSI) samples [PMC3279428]. The gene for hsa-mir-620 displays length variations with 15 alleles found in healthy individuals [PMC3279428]. References: [PMC9692299] [PMC3375551] [PMC8798919] [PMC8861492] [PM8607136] [PM3559822] [PMC7882724] [PMC3279428]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUGGAGAUAGAUAUAGAAAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications