v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 678 (LINC00678) URS000075B645_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC00678: LINC00678 is an annotated but still uncharacterized long noncoding RNA (lncRNA) that is highly expressed in monocytes and may have a potential role in monocyte regulation [PMC5890390]. In a study using over-passed human induced pluripotent stem cells (hiPSC) as a model strain, LINC00678 was assessed as a pluripotency marker RNA [PMC9622575]. The expression of LINC00678 was found to be subtle in all assessed differentiated cells, suggesting its potential as a reliable marker [PMC9622575]. LINC00678, along with PR/SET domain 14 (PRDM14), was found to be useful for RT-qPCR assay for the detection of undifferentiated cells [PMC9622575]. Additionally, LINC00678 is transcribed antisense to BDNF-AS, a lncRNA involved in the regulation of BDNF and implicated in various psychiatric disorders [PMC3789755]. In the context of human embryonic stem cell (hESC) differentiation, LINC00678 was highly expressed at the beginning period and may have a putative role in stemness maintenance [PMC10010006]. Furthermore, LINC00678 is among the lncRNAs associated with hESC-specific SuperHypoMarks and may serve as potential novel markers for stem cells [PMC4705665]. During the transition from iPSCs to neural progenitor cells (NPCs), LINC00678 was one of several lncRNAs that were down-regulated [PMC3789755]. References: - PMC5890390 - PMC9622575 - PMC3789755 - PMC10010006 - PMC4705665

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CUUACCUACCCAAAUCCUAUAAAUUGCCCCACCCCUAUCUCCCUUUGCUGACUCUCUUUUCAGACUCAGCCCACCUGCACCCAGGUGAUUAAAAGCUUUAUUGCUCACACAAAGCCUGUUUGGUGGUCUCUUCACACGGACACACAUGAAAUUUGGUGCCGUGACUCGGAUCGGGGGUCCUCCCUUGGGAGAUCAAUCCCCUGUCCUCCUGUUCUUUGCUCCGUGAGAAAGAUCCACCUACGACCUCAGGUCCUCAGACCGACCAGCCCAACGAACAUCUCACCAAUUUUAAAUCAGGACCUACCAGUCUGCCCUGCUCAUACUUGAUCUGGAUGAGACUGAUACCCUGCGAGACGCAACAGAAUCAGCUCCUGGGAUUGUGUUAGCAGAAUGACGGGAGUGUGAGAUCCACCACAUGGCGAGGCACCCCAGGAACCUGUUUUCUUCUUGAAGAGCAACCGAGAACUAUUUCCAAGUUAUCCUUCACUUUGAGCCAGGCAAUGGUCAGGUGGAGUAAAACAUAAGGAAGAACAUCUUUUUGGUUCAAAGCAUGAAAAAAAUUGGGACAGCAUGGAGGUGUCUGAUUUCUGCUUGGGCUGAGGAUUCAGGAGAAGAUGUGUGGAACACAGCCUGGACAUGCCCCAACCUGGUUGAUGAAUUCCACCCCAAGUAGUGGAAGAAACACACCUACAACAUGAGCAGAGAAGAUUUUUCUUCUGUACUUUCCAGGACUUGAAGCUGCUUUGUUUUUUGGUCGCUGGGUGGGGAAGGAGGAACAAUAGUAUAGCUUCCAGAAGAGAGAAGAGAGAUAUCUCUUGAGUGUGAAUUAAGCAGUACCAAGAGGCCUCAAGCUAGCUCUCUCUCCUGCUUUAAAUUCUACUGUUAAGAGUUUUUCUUUAAGUUUAAAACCUUGAAAGCUCCAUGAUGCUCCUGAGUAGAACAAUAAAGCCAUUAGUAGUCAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications