Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Struthio camelus australis microRNA mir-375 secondary structure diagram

Struthio camelus australis microRNA mir-375 URS000075B612_441894

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCUGGCGUCGAGCCCCACGUGCAAGACCUGACCUGAACGUUUUGUUCGUUCGGCUCGCGUUAGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 36 other species

  1. Acanthisitta chloris microRNA mir-375
  2. Amazona aestiva microRNA mir-375
  3. Anas platyrhynchos microRNA mir-375
  4. Apaloderma vittatum microRNA mir-375
  5. Aptenodytes forsteri (emperor penguin) microRNA mir-375
  6. Balearica regulorum gibbericeps microRNA mir-375
  7. Buceros rhinoceros silvestris microRNA mir-375
  8. Callipepla squamata microRNA mir-375
  9. Calypte anna microRNA mir-375
  10. Antrostomus carolinensis microRNA mir-375
  11. Cariama cristata (red-legged seriema) microRNA mir-375
  12. Cathartes aura (turkey vulture) microRNA mir-375
  13. Chlamydotis macqueenii microRNA mir-375
  14. Colinus virginianus (northern bobwhite) microRNA mir-375
  15. Columba livia (Rock pigeon) microRNA mir-375
  16. Cuculus canorus microRNA mir-375
  17. Egretta garzetta microRNA mir-375
  18. Eurypyga helias (sunbittern) microRNA mir-375
  19. Gallus gallus microRNA gga-mir-375 precursor
  20. Gavia stellata microRNA mir-375
  21. Leptosomus discolor microRNA mir-375
  22. Manacus vitellinus microRNA mir-375
  23. Meleagris gallopavo microRNA mir-375
  24. Mesitornis unicolor microRNA mir-375
  25. Nestor notabilis microRNA mir-375
  26. Nipponia nippon microRNA mir-375
  27. Patagioenas fasciata monilis microRNA mir-375
  28. Pelecanus crispus microRNA mir-375
  29. Phaethon lepturus microRNA mir-375
  30. Phalacrocorax carbo microRNA mir-375
  31. Phoenicopterus ruber ruber microRNA mir-375
  32. Podiceps cristatus (great crested grebe) microRNA mir-375
  33. Pterocles gutturalis microRNA mir-375
  34. Pygoscelis adeliae microRNA mir-375
  35. Tauraco erythrolophus (red-crested turaco) microRNA mir-375
  36. Tinamus guttatus microRNA mir-375
2D structure Publications