v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1412 (LINC01412) URS000075B531_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01412: LINC01412 is a long non-coding RNA (lncRNA) that is highly expressed in LUAD (lung adenocarcinoma) cell lines [PMC8044985]. It is located roughly 2 kb upstream of the ZEB2 TSS (transcription start site) [PMC7471508]. During neural differentiation of induced pluripotent stem cells (iPSCs), both LINC01412 and TEX41, another lncRNA, are expressed at very low levels [PMC7471508]. In a genome-wide association study of aortic valve stenosis, single-nucleotide polymorphisms in the non-coding RNA TEX41, located about 150 kb upstream of the ZEB2 TSS, were found to directly interact with LINC01412 and the ZEB2 proximal promoter region [PMC7471508]. LINC01412 and TEX41 are located about 2.6 kb and 160 kb upstream of the ZEB2 TSS, respectively [PMC7471508]. In left ventricular tissue, chromatin interaction mapping identified regulatory regions that interact with the promoter region of ZEB2 as well as with the non-coding RNAs ZEB2-AS1 and LINC01412 [PMC5840367]. References: - [PMC8044985]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8044985/ - [PMC7471508]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7471508/ - [PMC5840367]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5840367/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AAUUGCACUCAAAGGAGGGACAAGCCACCACAUGGGUUGCCACAUCCACACUCCCAGAGAAAGCUUCACAUGUGAGAUAAAUGCACUCAAAGAUUCCUCACAAGUAGCUCUUUGGAGCUUCAGAUGUGAAAUGGAUCAUUCCUCAAUCUGUAAUAGACCCUUCUGUGAAGCUCUUCAAUCAAACCAGAGAAUUCAAGAGUUUCCAACACCUAAGAGUGGUAUUUGGCAAAUGGUGGGCCAAAGGAAUAAAGAAGGCAUGCAAAACUCUUGACAGAAGACAUUCAGAAAUUGAUUUGAUAUCAGAUACAAGGAGAAAAUAUGCCAGUAAGAAAAUGCAUUUUUCAAGAUUAAAUUCGGCAUUUGUUACUUAAUAGCAUUUGUCAUAUUCCAAUUUUUCAUAUGUAGUAAAUUCAUUUCAAAUCAAAAAAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications