Homo sapiens (human) microRNA hsa-mir-655 precursor

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-655 precursor URS000075B3AB_9606

97 nucleotides
7 databases (ENA, Ensembl, GeneCards, HGNC, MalaCards, miRBase, RefSeq)
Found in 0 other species
250 publications
1. transcript
2. pre-miRNA

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR655: MIR655 is a microRNA that has been linked to oxidative stress for the first time [PMC6720387]. It has been found that miR526b and MIR655 regulate the production of reactive oxygen species (ROS) [PMC6720387]. Additionally, these microRNAs show increased expression during cellular oxidative stress [PMC6720387]. Furthermore, certain COX-2/EP4-induced microRNAs, including miR526b and MIR655, have been found to contribute to the upregulation of vascular endothelial growth factors (VEGFs) that induce lymphangiogenesis [PMC7956318].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

AACUAUGCAAGGAUAUUUGAGGAGAGGUUAUCCGUGUUAUGUUCGCUUCAUUCAUCAUGAAUAAUACAUGGUUAACCUCUUUUUGAAUAUCAGACUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure

Publications