Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-655 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-655 precursor URS000075B3AB_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mir655: MIR655 is a microRNA that has recently been associated with the regulation of reactive oxygen species (ROS) production, marking the first time it has been linked to oxidative stress [PMC6720387]. This microRNA, along with miR526b, demonstrates increased expression levels during conditions of cellular oxidative stress, suggesting a role in the cellular response to such stress [PMC6720387]. Additionally, MIR655 is implicated in the upregulation of vascular endothelial growth factors (VEGFs) that are known to promote lymphangiogenesis; this process is believed to be induced by certain COX-2/EP4-related microRNAs, including MIR655 [PMC7956318].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AACUAUGCAAGGAUAUUUGAGGAGAGGUUAUCCGUGUUAUGUUCGCUUCAUUCAUCAUGAAUAAUACAUGGUUAACCUCUUUUUGAAUAUCAGACUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Relationships

Molecular Relationships

2D structure

Loading 2D structure...

Expression Publications